Description :
From Genome Similarity Track
Location :
Scaffold_1449:730- 4474
Sequence
3744 bases(100 bases per row)
GTGGCCGGTCTACGGGCCAAGTTGAAAATCAAGGATGGGGGATCCAAGGTACTGCGGGGACATGTGGATCATTTCATCGAAACGTTGGGAGACGTGGATC
TGGCTGACAGGCTGACCCTGTTACGTCTTCCCGACGCAGATGAGCTTGAAGAAGTGCTGCGGGCTGTGGATCGCGCGAAACATCGCCAGAAGAAGGCGGC
GGTCGGATCCGGCAAGTATCGCTAAAAGGCTCCGACGCCTACGGCTCCAGCTCGACGTGTCCACCAAGTCACGGCGGAACTGAATCAGGATCCGTCGGTT
CGGACTCCGACCCTGAGGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACTACTCTCGACCGGGGGATAACGTACC
CGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGC
TGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCA
AGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCTGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCAGAGAAGATGTTAAACTA
GGACGCTCGCCGGGTTTGAATCTGGTACGAGCTGAGCGTTCTAGATATTGCATTTATGCATTTGTATACAAGACAGCGCTAGATCCAGGTAGCAGGACCC
TAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTTTCTAGTTTGCGCGAAGTGGATGAATTTGCCAGATCCGAAGTCTCTTC
AACCCTGGATCTACAAAGGGGGGAGCGCGCAGTTACTGGGAGAAACGACAAGATGGTCAATGGTTTGAGCCTATTAAGGGTGAGGTCACTGCAGATCCAC
CCCAGGTTTGTCAGGTCACTGGATCCCGCGGATCTGAAGATGTTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGAATACTGGAAGTACCATGCCCC
AGGAAAATGGCTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCAACTCCTCGATAGTGGTGCCGAGGTGTCTATACTAGATACC
GCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTAGTGGAGGCATGTACCGTACGAATGGAAGAACGCGGA
TCAAGATCACGCTGGCAGGTTGTTTGGTATACTGGTTCGATATTTGGGCTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACC
GGCCGGAGTAAGGTTGGATCTGGCGGATGAGACACTGTGTTTCCCGGATGAGATGCGGATCCAGCTCAGCGGACGTCGACCGTTGCACGGGGCGAAGATG
AGGATCATAAGGGCGGATAAGACGACCTGGATTGAGCCCGGAGAAACCTGGGGGCTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACGGTGGGTCA
CTCGGGGTGAGAAGTGGGTGCCAACAGTAATCCAAGGACCAGGTCGATCACAATGCCTCCAGGTCACGAACGTCAGCGACAAGAGACTACTACTGGACCA
TTATGAGGAGGTTGGGCGATGGTTGGTGAAGGATGGTATCCCTAGGCGACCTGAATATGTGTCAGTGGGATCCCATCGCTACAGAGAATGGCAGAATCTG
GCGTGCGAGGCGACTACCGAGATCGAATCCCTCGCGGACGTGGAGCTCCCGGCGGAACCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCTC
GAAAGATCCTACAGAGGGATCGTCAGATTGGTATCCAAGTGGTAGAGATTGGATCCAAAACCGCTGGCGATACCCAGATCCGGTCCTGCGATAGCCCAGG
GTTTGTCGAGAATGGCAACACCGGCTTACCAGGAACCGTCGTGTGTAAACTCACCAGAAGGTCAAGTCGATCCAAATGGTAGTCTCCCGGTACCAGGATA
CCCGATCCCATAAAGACAGAAGGAATGACGGGTGAAGGGGAGTCGCGGTGCTTGGATCCAGTAGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCT
ACCATGAAGGCGGGGATCTACACGCTGAAGATCTCGGAGAAGGTATGGCGGTGATCCCGGAGATACCACTGACCACAGAGGAGGTCACGATTGATGATAT
CCAAGTAGATCCGGGGGCGAACGAACCCGCGGAAGTGGATCGGCTACATCAGAAGATCTGGGAAAGCCGACATCTGCTAATTGGCAAAGGACATGCATTA
CCACCAGCTACACGTGGAGTCAAATGCGACATCGATGTCGGTGACGCGAAGCCGATCGCTCAAAGGGTGCGGAATGTGGCGCCTCAGGTCCGAGAAAAAC
TATAGTATCTGATTAAGGGTCTGCTGCAAGCCAAAAGCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCGTTAAGAAGAACGGAGT
GGATATACGTCTGTGTATTAATTACCGACTAGTGAACGGCCTGACCCGACTGATGGTGTATCCAATGCCTCTAATCAATGAGATATTGGAAGATTTGGAT
AAAGTACTCTGGTACTGTTATCTAGATATGGCCAGTGATTTATGGGTGGTGACTACGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCATTTG
GACTGTTCGAACGGAGCCGGATGCCGTTTGGATTGAAGAATGCACCCCAGATCTATCAACGCCTGATCGATAATGCCCTCTACGGAGTTACCCGAATACC
GGAACCGGAAAGAGGTGGACCAGGGAAAGGTCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGC
AGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCT
CTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGTGTGGTGTAGCGGGATCAGCAAAATCTG
CGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCTGTGTTCTGCTGAACTTTCCTCACCTTGTGT
ACCCGTCGGTAGGGCGGGATCTTGCTCTATCGGTAACTTCCGAAGCGTTCAAGTGGTGAGGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCA
GCAGTGGAAAATCTTCACTCTGCATCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGAATCTGGCCGTAG
GGTTGCCTTACGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAATTGAGAACCTCTAGGGTGT
AACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAATGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATC
ACTACCAACACTAGATTCGCAATTCCCAACCTTCTCCGAGCTCG