Description :
From Genome Similarity Track
Location :
Scaffold_400:730- 2487
Transcript NameFunction/comments
Phyke_g9214hypothetical protein
Phyke_g9215hypothetical protein PHYSODRAFT_518857

Sequence
1757 bases(100 bases per row)
GGTTGGGCCTGACTCCCCAGCCACGGATCGTTTGCTCCCTGCTAGGCAACACAAAAGGTTCCTGCGCGTCGAGAATACCGCGGgcgaggatgatgaagag
cggGCTATATCAGCTGGCGTGCTGGGCAAAGTTTTCAACAAGGTACCGTCTACGATCAAGAACTCGAAAGTTGGTTCGAAAGTGAGATACCAATACTGGC
TCAAGCGCGGAGAAGACCCGAAAAGTATACACAAGAAGCTGGGACTGAGCGGTTTGACGCCGATAGAGGCAGAggcgaaggtggtggcgtTTCGTGACTA
CATGGGGTTTTCCAAGTTGTGGAGAGAGCAGTAGAGTTATCTACTCGACAAAGTGAGGATGAGAATAGAGTATACCCTCTACCCTtgccagcatctgcag
cttggatATCGTTCTTCATATTGATGGATTAGCGTGGCCAATCAAGTTTATTGCGTATTCGGCCGAGAGCGAGTTTGGGTAAACTGGCACTGCAGCCATT
TTAGTGCAGGCTTCGATCAATGATGCGATTCGGCTACCCCAGTATAGGCGACTGAGCGCTGCGCAACAACAAACTGATCGCAACCAAGTTTTTTGTAAAT
ACAGAGGTGTCTTGCTCACTGTGGGGCAGTGCTCTAGTAGGCAAAGCATACAGACAACTTCACAAGATGATAACAGTCACATCCATTGCCTAAGTCACTT
CTGTTGTGCAGATTGCTGCTACCGGGATCAGCTTAGATCGAGTCATCCGCAAATGAGCTGCGGAGGCTGTGGTTGCCAGATGTGTAAAAACTACCGAGAC
CGCAGGGAGAAGCAATGCATTCCATTAGACTTTAGATTTTCCGGTTGCTGTAACGCGTGCGATTCACGTCTCACTGAAAAGCGAACCAGCCATCAGATAT
GTTATAATATTGGAGATCAATATCATCCCTTTCGTGGGGAGCTGACATCGTCACTACCTGACCAATTCGTGTCTTCCCATATTTAGAGGGGGTGCAGTGC
TCTCGGAATAGCTCTGTCGATAGAGATCGACACGCCGCGAACGACTTTAGTCTTAACCACCACGAGCAACTGCGTAATGAAGCGAAAGGAGCTATTGACA
GTATGCGAGCAGCTCATCAAGTCGTTCGATCCCGCTAAAACTACAGTGGACGCTCATGCGACGGAGGAGCTTCGAGGGTGCTCGTCTGTAAGTGACCAGC
GatttctgcagcaagttCTCTACGGGTCCTACCGCTATCGTGAACTACTGCGTCCAATGCTGACGCATTTTTTAGATTCCCACTCAAGCCAAGTGAGTCG
CTCAGACTACACCATGTTCCTCATCATAGGGTACTTAGCCATCTTTCGTATTGAGGAGCTCGGTATCCCTGCGTTTTCCGGCTTGACGTTGGCACTCCAA
CCTACCAGTATGCACACCTTCCTTTCTTACCTTTTTGACCCGAGCCAACTTCGAGGAACTCTGTTCACGCAATGGGCCCAGGTTCTCGATGCCGATTTCG
TTGAGAAGAATATTATCGACAAAATGATGAATTTTAAGCCGGAGATTGACAAACTCCTTTCGCAACTTCACACCAAAGCTTTcggtcgagctgcttcagc
acgagACGCGTCAAGCTTCGATCCCAGCAATGCCAACGATCCTGGTATAATTGAGAGCTCTAGTAAGCCACCCACATTACCAAAAGTGCCAAATCTCACT
CAACCAAAGCCTCGCCGTGCAATGGAGCCCGTTCGAATTTCACACGAGGTGAAAGCG