Description :
From Genome Similarity Track
Location :
Scaffold_1986:730- 2463
Sequence
1733 bases(100 bases per row)
AGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTC
GAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCG
GCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGGAACGAGGAACGAGTCATCTCGTTCCAGTCCCGGC
AGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGCTCCGTGTTCACCTTCTGGGCTCTAG
GCGCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAA
TACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCACTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGCGA
CAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCGTAAGGCCGGAACGAGCGCGAAGCCCGA
CTGGCTCTCGTCGCGACAGCTCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGTCCACTGATCCTCCACGGGTGGTC
GTACCCAACGACGAGGATCTGAAGTTCGACATCATCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCT
CTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGTGAAACATGTCAGCGGGTCAACCCGCAGGGCACTCTTCGGCT
CCACGACAGAGCCTGCCCGTACCGGCTGATTGTTTGAAGTCGATGAGACTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTT
TGGTGCTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTT
CCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTG
CAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCAC
GTACGTGGTCGACGCAACTTCCAGTTGTTGAGTTTGCGCTCAACAACACGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCA
TCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGTGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGA
CCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATACCATGGCAGCGGCCCAAGATAAACAAA
AGGAGTACTCAGACAAACAAGGAAGAGAAAACT