Description :
From Genome Similarity Track
Location :
Scaffold_3621:73- 2441
Sequence
2368 bases(100 bases per row)
GTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCG
CCCTGATTCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGTACGAGGACACGTTGACGGAGGCGGTCAACCTTAGGGTC
CCGTGTCCGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCG
GAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTTAAGTGGAGAGGTTATGCCCACTCC
GAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGG
CTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGAGAGCGCTAGAAGCCGCGCGCTTCAAGATGTCCCTTGGCAGCATA
CGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTG
AGAACTTGAGAGTCTCCACCTACGCCCAGAACATGTCCTCACAAGATCTCCACGTGAGACAGTTCTCGGGCATAACACAGGGGGTATCCCCAAACAGGAT
AGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTTGCGCGAGAAGCACACACCAGAGCAGCCTCCAAGT
TGTCGACGAATACTTGTTCTTTCTGAACAAGGGCTCGGTCATAGATGCCCCTAGAAGTGTGGCCGCCCCCAATGCCACGAGGAGCGACGAGAAACTCTAA
AAAGAGGTCAGCCCCAAGCTCCTCTTCGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACAC
GCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTC
CTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGC
TTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAG
TGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGAAACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTG
CTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGT
TCTACGAACCGAGGGTTCGGACGATTGTGTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGA
TCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCG
TGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGT
AAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAA
ACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTC
ATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAAC
CACAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCAGTGAACTGCCGTT
CACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA