Description :
From Genome Similarity Track
Location :
Scaffold_271:73- 1731
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015084Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
1658 bases(100 bases per row)
GGAAATCAATTCTTCGACTGAACTTGGGGGATTTTCAATCTTCATGTGATGGATTACATCGACGTCACCATCTTCGTTCGAGACCAGAACGTTCACAAAC
TCGCTTGAAATGTCTTGTGCTTGGACACTTCCTTCGTCATCTTGACTTGTACCTTGATCAGGGGCACTCAAAATTCTTGGCGGAACACTCTTCTTGCTGG
TCTTCTTCTTCTTGCCTTGGGATGGGTCTCTGCCTCTTTTCCCGTCGTTCTTCACACTACCATCGCACGCAATTTTGTCGTCGATGGCAAAGGAGACAGT
CTTTTTATGGCGCCTGACTGCTCCACCTCCGTTCGTCTTCTTCAAAATGGGTGCCGCTTGTGAGCATGGGGGGCCATCGCACACCGCAATATCACAAGGG
CCATCTGGGACTTCTTCCACAGATGTGTAAACCCATACCACTTCATCCGTTGTCATGCAGCTCAAGTCGGCGATGCACGACTTGTCAACGGAGACCTTCA
TCTTCATCCAGTCAATGCTAGGTTGGTAACGCTTCAACCATGGCATGCCCAGGATGATATCAAACTTGTCATCGAGGTCGAGTAAAATGAACTCGTCTTC
ACCTCGGAAATCTTCATACTTCATTGCCAAGCGAACAACTCGCTTTGGCATCTTCACAGTTGACCCCTTGGCCAACCGAACAATCATTATCTTCTCTTCA
TTCGCAACAGGCACAGAGATGTTGTGCCTGGTGATCACTTCATTTCGAACAAAGTTGTTCGACGCACCAGTGTCACTAAAGCACGTAGAGGCGTTGCAAT
ACCGTCTACATGAACTTTGAGACGATCAAACTTGACGTTTGACTGACACTGCTCTCACTCGTGGAAACTGCATGTGCATCATGCACATGGGGCAGAGTCC
TGTGTTTCACACATCCACAGTCCTCTTCTCGAGCCCAGTAGGAGGCCCCGCCCCTACTGGTCGTTCCCGTCTTTTGACCTTTGGGAACGATCGAACCGAC
GACCATTACTACGGCCGTAGTTGTTCGAGCGCGAGCCCTGTGCCGTTTGCCGATCAGGCAAAGACACTTTGCAGTTTCGAGCGAAGTGGCCCGACTTCCC
ACAACGGAAGCGCTTTCCATCGTTGTGAGGACGTTCATTTCCAGGAGTGGAAATGTACGAGATGTCCATTGGCTCTGGACCATCATGAACGACGTTCGAT
TGCCTTGGTGGTCTTGACGGAAAACCTTGGAACTTGGCTTGTTTGATGCTAAACTCTTCTTGCATCGCACGGCTGATGGCTTCTTCAAGGGTCTTTGGGT
ACTCACGGAACAATTGGTTCCGGATTGGACCGTCGTTCAGACCCGTCATGAACGTCACAACTTGCGTTGGGACGTCAATCGGCTCGTCCACAATGCTCGA
GACCAGATAACGAGCTCGCTGAGCATATGAGTGTAGATCGAAACGACCTTGGCGAAGTTTGAGAAACTCGGCGCGTGCACGGAACTCACTCTGCGGTGGT
TCAAACGCCATCTTGAGTTCTGCCTTGAAATTGTCGTAGCTATAGAAGCAGTTTGGATCGGCCAAACGCTTCCCATAAGCCCAGCTCTTCGCACGACCCG
CAAGGTTGGACATTGCGAACAACACTTGCTGCGAGGGGTCGCGGAGTTGTCTTGCAGA