Description :
From Genome Similarity Track
Location :
Scaffold_952:73- 1632
Transcript NameFunction/comments
Phyci_176071hypothetical protein

Sequence
1559 bases(100 bases per row)
accgccacttcaccacttggcctgcaggcacactcacctcgtcgatcttgtcaccgccggatttgatgttcacggccacgtcctcggtatcaacgctttt
gaaggtaatcgtggcggtgccgtcgccaatcctcgtccacatgccgtcactgttgttgaaagcgccttttacgatggacatgcccagcgcctttttcaca
ctaccgtcgtctatctcgccgacgagctccgtgggcgcgcagatcggctggaaaaactcggaaatgaccgacgagacgtaccaccagtcccaaatggcgt
agaaacccatggctctgtctgcaactttgaaagtgtactctttggcactgaggaaagtgccgttgctgctggttccggagctgatcaggtcgtctacgat
ggccgcaaacgtcttgcgcagagttccgcgtctgacgtaggccgtcgcctcatccgattcggcgatcaactcgttcatgcagttgtttgtcgcgacaggg
atgtcgtggagtacgaggttcgactcgctcatgatcactcggatatcgccctcggagatgcctgggtttagtcgacgcaactcggccacagtcatccacg
tgcgatccagcaggcgcttcatgtcgaagccacaggtcgaattggacttGAGTGCCGTCTTCAAGGACGTGATATCCGCCTCCTTCAGCGATTTTACTGT
CTCGCCCAGCGTGATGTTTTTCATGAAGCTCGCAAACCTATCCCAACTGGACACGATGGCGGCGCCGTTCGCTATGATTTCTCGCAGCGCATACTCGGCA
GTGGTGAGCACGCTGTCAGCAAACTTGACTTCATCCGACGCTTTTCCCCCCATACAATAGGAGATCGTCACGGGGATGTCGATAATGACGTTGTCGGACT
GGTAAAGGATGGCAAGAAGCTTGTCTGCGGGTGTATCTGGATTGTAAACCATGATGTAGCGGATGTACTTGATGAGCGACTTGGTGAGGCTGAGCAAGTA
TTTGGTGCACTTGATAGCGAGTTGAATACCCTTGGCCCACTTGGACATATCGCCGTACAGGTCCCACGAAGCAAGCGCCAACGTGGTCTGGATCACGACG
GCCGTCTTGCTCAGGATTGCGAGCGTgcagtcgtcgttttgtcggatgcactcgaggccgcactcgacgggatacgaatacggacactccatccagcacA
CGCCGAGTGTCTTGTGGAACGTCGCCGGACACGTCTTCGCGATGTGCGTTTTGCGCCAGCACGCGGACGAGATCGACGTGTCGAGCGCAGAGCCAACCCA
GTTCATGTAGGTGGACTCGATCGTGCTGGTGGCGTTCATCACGCTGCCGAACTTGAACGCAGCGTTCAGGGACCCAATCGCCACCTTGGATGCCGCTGCA
GACCCGGTGTTTGAGTTGTCGTCCACGGAGTCATCGTCTCTCTCTTCGTCCCTGGTGTCTTCCGAGCCGCCATGATCTTGCTCTCGTGCCTCGTCACGGG
TGTTTGGCAAAGATGCTGACTCATGTTCGTTGTCGTCTGCGACGTCGCTTGTGTAATTG