Description :
From Genome Similarity Track
Location :
Scaffold_3380:73- 1425
Transcript NameFunction/comments
Phyin_T30-4PITG_22477Putative uncharacterized protein

Sequence
1352 bases(100 bases per row)
GAGGGCAAAGGTGGAAGGGCAGCCGATGGGCGAAGGAGGAAACAAGGACGGGATTTTAAAGGAGGAAAGAGGACGATGATGAAGGATACGGGCAGCAGCG
ACTTCGAAGGAGGACGAAGAATTTGCCAGGTAAGAAAAAATGTATGCAGCTTTTTTCTCCCCTTGACGATACTCACAGGAAGGTGTTGTACTGTTTCAGT
AGTGATATTTCGGAGGAAATGGAATCCATGCCAGAGCTCTCGGACAAGGAGGACGAAGTGACGACGAGCAGTGGTGTCAGCAGCAGCAGAGCCGCCACAG
TGGATTTGGAAAAAGGATACCCGGTGTGAACAGAGAAGAATGCTTGGGAACAGTTAGGATTAACATGGAGAGAGCTTTGAAAGAGGGTGGGTGGTGAAGC
ATTCAGCGAAGAACAGAGCAACAGGTAGAGTAGTTTTTCCACTCCAAACTGTATTCTAGTGGCCGCTGGCATCGTTTAGCAAGCCAAACATGCGTCTGTG
AATCTACTTGCGCTTTCCTGAGCCCATCAGTTTGTTCAGCAGGTTTTGGTTATCGAAAGCCTCTGGGTGGATGAAGTAGTGACGGCCACGAGCCTGGAAC
GAGATCATCGGGTGCATCGCCTGTGTAGGAGGAGTGACACTGGACAGTCGGAACGAGTGCTGCTCCAGCTGAGCAAACAACGTCGTCGTCTCGACTGTCA
CAGTCGGGTCATCTTTTGTATCTGCAACGGACGCCTGATTAGGGCCAGCAGATGTATTTGCCAGCCACATCCGCATCACATACGGCTTGAACAGGTAGTG
AAAGAGTGAGGTGGAGCCAAAACCGAACAGCATGATGGTGCCGCACATTGCCCACTGCAGAGCGAAGGTAACAACAAAATATAACCAGCGTCAGTACCGT
GCCGGGAACTAAGGTTTACAGCCTTTTGACTATTGTCTACTAACCTTGCCGACAGAGGACGCGTCTTGCTCACTGAGCACACAGAGCACGGGCATTCCGA
TGGACGTGAGAGTGCAGCTGGTGACCGACACGGCTTTCATGAGGCGCACAGCGCGCGTCATGGGCGCCTGGTACACAAGATCTCCGACTAAATTCTCCCC
ATTTTGAAGTGGATTGTTTGCCTTATCCTCTCGAGCCTCGTCATCAGACTGAGACGAGCTGAAGTGCCGAATACAGAACTGTTTTTTAAGCTCAGCACTG
CAACGGCTGCTGAAGTCAAACGATGCTCCTTGGATCACAGCTGTTTTGCTAGTACGAACGGCGGCCCGGGAAGCTGAGCGCAGAGAGGAAAGCTGCCTCG
GGAACACCTCCACGAGAGGCCCTGCACGGCGTGATGTCCGCAGCATGAACAT