Description :
From Genome Similarity Track
Location :
scaffold_547:7298- 9343
Transcript NameFunction/comments
Pl_103924myosin-like protein

Sequence
2045 bases(100 bases per row)
TGGACGAGACGACGATCCTGTCGGCGCTTGAGACGCGCTTCGCTCAACAGAAGATCTACACCAATACTGGAGCTATTCTGCTAGCTGTGAACCCGTTCCA
GAAGATCCCAAATGTCTACAGTAAAGACACAATGGCCAACTACCTGCTGTCGTTCGAAGCTAGAAGCTCCTCGATGCGGAATAAGGGAAACGAACCCATG
CCCCCACACATCTACCAAGTGGCTGGAGAAGCGTACAAGGCCATGATGTTAGGACTGAATGGAGTGATGAGTGACCAAAGTATTCTCGTGAGTGGAGAAA
GTGGAAGTGGCAAGACAGAAAGCACCAAGTTCCTCATGGAGTATCTCGCACAAGCCGGAGCGAATAATCTTGCGGCATCTGTCGCGGGTAAAAGTCCTGA
AGGCATTGCAGCTAAGGTTCTCCAGACGAATATTTTGTTAGAGTCTTTCGGTAACGCACGCACTCTACGCAACGACAATTCGAGTCGATTCGGCAAGTTT
ATCAAGCTGCACTTCACCAGTGGAGGCAAACTCACAGGTGCCAGTATCCAGACATATTTACTCGAGAAGGTACGACTGGTATCGCAGTCCAAGGGTGAGA
GAAATTATCACATCTTTTACGAAATGTCGATCGGCGCAGCTCCCGCAGCTCGCAAACGCTGGTTCCTAGACCCACCAAAGGGCCACATGATGCCTCCTGG
TGATCACGGTGAGGTTACGGATGCTACACGACAGTTCCTACATTATCGATATTTGAACCAGAGTGAGTGCTACCAGCGTCGTGATGGTGTGAAGGACTCG
GACATGTTTCGACGAGTCATGGACGCCATGGACATTGTGGGCTTCACTCAGGCGGAGCGTGCGGGTATTTTCGATATCTTGGCTGCACTCATGCACATTG
GTAATTTGTCTTTCGAGCACGATGAAAACAGTGACAAGTTAGGTCAGTCAATGGGACCTGGTGCTGGCAAGTCTGATTTGGCACCGAGCTGTATTTGGTC
TCGTGATGCGGCTGCTACGCTAATGGCTGTGGACGCGACCAAGCTGGAGCGAGCGCTGAGTGTGCGCAGAATTCGTGCTGGTACTGATTTTGTGAGCATG
AAGCTTTCGGCAGCACAAGCCAACAATGCACGCGACGCACTGGCGAAGGCGCTGTACGGCCGTCTATTTGACTGGATGGTGAAGAAAATCAACCACTTCC
TCAAGATGGACGACAGCCAAAAGGCGAAGGGCGGTCTTCACTTTATCGGTATTCTCGACATCTTTGGTTTCGAGGTGTTCCCCAAGAACTCCTTCGAGCA
GCTATGTATCAATTTTGCCAACGAGACGCTGCAGCAACAGTTTAATGACTACGTGTTCAAAGCAGAGCAGCGTGAGTATGAATCACAGGGCGTCGACTGG
AAGTACATTGAGTTCTGCGATAACCAGGACTGTGTCAACTTGATTTCGCAGCGACCAACTGGTATCCTGTCACTTATTGATGAGGAGTGTGTCATGCCAA
AGGGAAGTGACACGACATTAGCATCCAAGCTCTACCGCGCGTGCGGCAGCCACTCACGATTTGAAGCTTCTCGTATTCAGCGAGCACGTGGTCTCTTTAC
GATTGTACATTATGCAGGTCACGTAGAATATTCTTCAGATGGGTTTCTGGAGAAGAACAAGGATGTTCTTCACCAAGAGGCGGTGGATATGCTTGTGTAT
TCCACGCGGGAAGACAGCTTTACGCGTATTTTGTGTGAGGGCTTTGGTGGCTCGCGTGACCGTGCCAAATCTTCTCCACGTCAACGCGCACAAACAAGCA
AACACCGAGGCGCAAGTGTTGGTCTACAGTTCAAGGAACAGTTGACAACTTTGTTGGAGACACTACACCAGACAAACCCACACTACGTGCGATGCCTCAA
GCCAAATGATTTATGCAAGGCAGGTATTTTCGAGCGTGACCGTGTATTGAACCAGCTGCGTTGCAACGGTGTCATGGAGGCTGTTCGTGTGGCGAGAGCA
GGGTACCCGATTCGTTTGCCGCTTAATGAGTTTGTTGCACGTTAC