Description :
From Genome Similarity Track
Location :
Scaffold_29:72977- 78828
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.14Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.107 transmebrane protein Gpr8
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.15Conserved gene of unknown function

Sequence
5851 bases(100 bases per row)
TATAAGATTCGGAGAGTGTTCGACCAGTTGAGTGAGCACCCAACACGAGAGTCTCCTTCAGGGTCACGCGCTGTCTGCGCAGCCACAACACAGCAAAAAG
AGGAAAGATGCAATGGCTTCTACTAGGAAGAGCCTTTGATATTCGGATACGTGCTGGAGGCGTCCAAGGCCACCCGCCACCCAGATGCGCTGCTTGAACC
TGCAAGCCTGATTGACGAAGAAGAAGTTCCATCTCTATTTCACACATGTGTTGACCTCTTCTATACACGAGCGAGGGTCGTCCCTATATACGCCGTTCTA
CACCCAAACTCCATTTGCAAGAACACTATGCATTGGGATACCAGCAGGTGAAGGAGCTTGCACAGCAGATTCACAATCAGCGACTGGAGTTACGCTTTTC
GGTGCCGGAGCCGCCCATGTCAAAGTAGCAGATGTGACACTCCTGGGTCTGCCAGTGGTACGAGCCGTCGAAGACCTCAAAGCCCACGGTGTACTCGGCG
CAGTACCGGTCGTGCAGCGCCTCCCACTCGCCGAGTGTCACGATCTCGTACTGCTTGGATGCGCTGGTGCCCAGTCTATAGTACAGTGGTAGATAGAGAA
TTAGTCCACTTGCGTGAGAATTCCTAGGGTTGCTTCAAACCATCATCATCAGCTATCAAGCAAGCCAATAACGTACGCTTGGGTCGCCTGCAGAGACTGC
TCGATGGAGAAGCCTGAGAGGAACATCGTGATGTACGGTGGCACCACATTGCGCTGGTGCGCGAGGCACACGAGCTCCGAGTTCAGGATCGGCCCCGGGT
AGTCGTCACCGAGACTGCGCACGAACTTGCGCCACTTGATGAGCCACTTCTTGGGAACCAGAAAATAGGTTTTCCCACCACAGTGACTGAGCGACAGGTG
CGTGTTGCCGCGCGAGCTCGCAGGTGAGAAGAGTTCATTCGGGTACCCGCTTTTCCGCAGCAACAGGTCCAGCAGGTCGTTCGAGCCCGCGATCTGCGAC
TCAAAGCGCTCCTGTTTGTGGATCTCCGCCTCTTTCTCCTTAGCCTCTTTGTCCTGCGCGCACGTCCAGCAATCCGAGGAATACAGCGGGAACCCGCGCA
GATCTGAAGCATACAGCGACAGTTTCGTGAACATGGATTTGGACAGCACAACACGCTTCGAGCGTCCAATGCAAAGTGACATTGGCAGCATCTCGCCATG
TGGACAAACGATCATCTCCCCTGCTTCCCGTGTCGCTACGATCTCTGTGTCCACGAACGTGAGTGCTGGTTTGGCAAGTACGCTGTTTCCAAGAGCTGTA
GTCTTCCTTCCACCGCGGGTTTGCTGTTGTAAACGCTCACGCTGCTGCTGCTTCTTTTTTGTGTGGCGGAACTGCATCAAGAACTGCTCGTAGCCCAGGC
AGCGCTTCTTCCACGCCAGCAGCCATGCCCTGCTCACAATAAAACTGGTCTTCAAGCTGCACGAGGACGCGGCGTCCTCGTACGACTGCACCGACGCGCT
CGCAATCCACTTCTTAAGCGTCATCACCTCCGCGGCACGCAGAATCGCGACCGAGCGCGGCCAGGACGAGTCGTCCTCGCGCAGGTTCACCAGCACGTCA
CCGAACCGGTGCTTCACCACCAGCGCAACCGCATCCTGCACGACTTGCTCGCGCGGATGCAGCGCTGCACAAGTAGCGGTGAGCTGCGCGACGTCCTTCG
CAGTAAGCAGCTCGAAGAGATGCGCCATTACGCCCAGCGAGAGGCGGTCCATGGCGGGTCAGAGGCTAGCGGGATGCGGAAGTTGGCTGGCTGGCTGGTG
GACGCGCGCGCTTGATCGATTGATGCGGTGCTTGCTCGCTGCGAGTTGGGCGACGAGGAGCTCTGCGGGAATGACACTAACCGGACCTTCACTCACACTT
TCAGTTGTTGTGAACAGTATTGGAAATCCTCGAATAAGTGCGTAATCAGGATTCCAAAGTTCAACTAAACGAGTAGCATCTATATGAAGCAGCACATTCT
TCCTCATAGAAGAGACTCTTCCATCCTTTCAAGATCCAAATCCGAAAGAAATCTCCATGCCACCAAGCAGCCGCAAAGCGTCTGCAACAAAGCCAACGCA
TTTAGCGACTGCGCACGCGCCAGAACAACAAGAACCTTCAAGCAAGCAAGATCAAGCAGTATGATGCGCTCGGACGGAAGCGCCAAGCAACACCCGCTCT
GGCTGCTGCTGCTGCTCGCAGCGCTCGTGGTGGCGCCCGCGTACGTGCGAGCGAGCGTCTACTCGGGCTACACGGTCAGCCGACAGTTTGAGTACATCGG
CAAGTTCTGCTTCACGTGGAAGCCGACGCTCGAAGAGATCGCAGGGGTAAGTGCGCTCGCTGTATGTGATGGGACTCATTCAACGACGTGTATTAAACGG
GAGCATCGTGTGTTGTTATTGGTTGACAGCGCATCACGGGCGAAGTGCAAACCGATGTGCAGGACCTGCAGCTCGCGATCTACGACGACGAGCAGCTCTT
CTGGGAGTACATCATGACCGACGACGACTGCGACTGCTTCTGCAAAGTGTCGTCTGAGCACACCAAGTACGTGTACAACGTCACGGCCACCAGTGACGAT
GACCTGTCGATTCCGTTTACGTTCAGCTTTGACATCCACGAGCACCTGCGACCGCGCTTCTGGTAAGGCACACAACCCGACAAGAAACCCATGCTAGACG
TCTTTATTTATGAGCCACGCCCTAATGTGTAATTTCAACAACTTGTAGGTACGTCGCGCTCGCGCGGTGTGTGCCAGGCGGAGACGCGTACGAGCCGTCG
TTCACGCAGATCACCGAGTCCAACTTCAAAAAGTACTACTTCACGTCGTGGTACAGCATCCACATGACGCAGGCGGATGGCAGTGAGCTTCCTGTGCAGC
AGCAGGGCATGACGATCATCTACGGGCTCATGACAGTGCTCTCGGCAGCGGCAGCGCTCGTGCAGGCGGTCGCAGCGCGCGGCATGCGCCAGTCCGAATC
GTTCCACCCGATCATGAAGCTGCTCACGATGGTCGTGTTCTTCTTCAGCGTCTCGAACGCGATGCTCTTCTTCCACTTTTACGTGTACCAGTTCACGGGT
GTGGGCGTGCCGCTCTTCGAGTACTCGGCCAAGATGATGCAGGTGTTTGTGCGCGTGGGCACGATCTTGCTGGCGATGCTCGTTGCCAAGGGCTGGACGA
TCAACAGCGTCACTCTTGAAGGACAGGAGAAGCTCTCGTGCCTCATGGTCACGATTCTGGGACTCTACCTCTCGATGGCGATGTGGTACCTCATCTGGCT
CGACCCGGCGTCGACGCTCTACATCTACGACTCGTGGCCCGGGATCGGCATCTGCATCCTGCTGCTCGGCATCCTCATCTGGTTCATCAACACTATCCTC
GACACGCGCGCGTACGAGGAAGCGGCGGGCAAACGTCGCTTTTTCGTCCAGGTATGTCGTAAACACGGTGATCAGTAGGTCATGTAGATGGATCACGCAA
CCCACTCACTGTTGGGTACACTGTATAAACAGATTGCCGGACTGTTCTCTGTGTACATCCTCGCGCTGCCGGTGATCGTACTGATCGCATCGTTCCTGTC
GCCGTGGGTGCGCGAGAAGACCGTCGCGGCGATCACGACGAGCGTCGAGCTCTGCATCTATGTGGCACTCATCTACTTGCTCTGGCCATCGCGCGCGCCA
CGCTACTTTGAGGTTCGTGCTCTCTCACTTCCTTGCACCACCAGCTCTGTTTCTGATTATGAGGTGACTCACAGTTCTTCTGATCTCTCTCTTCCACACA
GCGCCTGTACTCGGTCTCGTCGCCGTCGGAGAAAGCGTCGCTGCGTGAGCAAAACCTACCGACTGAGGAGCTCTAGCACTTTTCTGCTGCTTCCATCCTC
GTTCTTCTCGGCTGCATGCTCTCGATGCCGATGCCGATGCCAATGCCAATGCCGATGATGCATGTTTGAATCTCAATCCCGTTTGCCGCTCTTTACTTTT
CTTTCCCTTCCTGGTAGGATCCGTATCCATTTGTTAGTCTTCTTTGAATACTATTTCTCCATTTTCTTCCAAAGGCAACAGCTTTTTCTCGCTCTCATTC
ACTCAGATCACAAACTTGTTGAGCACTTGACGGAACTTCCAGTAGAGCTCCAGCGTCTGCGTTTCCACACGCGCCACGTCCGCAAGCATGCGCACCACTT
CGTCCGTGCACAGCGAGCTTTCGAAGCTCTTTAGGCTCGTGGAGATCTTCTCAGCGACCACCTTTTTAGACATTGGAGTACCACAAGCAATAGATTGGAC
ATACGTTAGTAGGCGTGGTCCAGTCAACTTGAACCAACGATTCCATGACCACATACAAACGCAACGTACCCCTGCTAGCACCTCTGCTTCAAACAGCGAA
TCTCGAAACTCGGCGGCTTCGAGCGAAAGCGTCGAGAACACGTCATCAAGCGGCATCGACATCTCTTCGTGGCCTGGGCATCGGGGTACATTTTCCACCA
GTAGCGCTCGCATCTGATCGCCCACAAGCAATATGAGAATGAAATGGAAACGACATAGAGAACACCGCACAAAATCTCGAACACAAGACACAAACTCACC
ACCGAGAGGTCTTCTACGCTAGAGCACTGGAGTAGAATCTCGAGCGGTCGCAGCATCTCGCCGTCGATCAGGATCGTACCCTCGGCGAGCGAGAAGCGCA
GCACCACGAGGTTCCCAGAAAAGGTCTTCATGCTGATCCAGAATTTACCGCTCTGGTTGCGACAGCTCTCATGGATCTCCGCATTCATCGACACTGGGAA
GTTCATGACGCTGCGCACGATCGCGACCACGTGGTCCAGCGTGAGCTCTTGCACCGCAAACGCTGGGAACACCATGGTGAATCGGGACGGCGGCGTGATG
TCGAGCTCATGGGATTGCTGCTGCTGCTGTTGGGAATTCTTCGTAGTATCCATGTCTCGCAACCACAACGCGGCAAACGACTTATCCTCCCAGTGAGCAG
CTAGCGCAGACCAAAGCTGGAACCCTTGCAGCAGCAGTCCAGGATGGTTGTCGTTGGTGTTGCCGTTCGAGTTGCTGTTGAAGCGATTGAATGATGGTGA
TGATGATGGCGGCAGGGAAGGGTCCTGGTCTTGACGGAAAGCAGCTCTGATCGCCATGTGGCTCGTCGGGATGCCGTCGCCTTCGAGGAGCTCACTCAAC
TGAACGAGATGGAATGCCTTGTCCTGCACCAGAGGCAATGCGAAGGAGAAGAGCGAGTTCCCATCCTCAGTCGTTCTTGAATCCCTACTGTTGGTATTAG
CCATGGCAGCTCCATTCTCTTTGTTGGTTGGCCGGTGTTGGAAAATCTGACCAGGCTGGAACACCAGCGAGCATGACACAAAGAGCATGCCGCCACTGTC
GTCCTGATACTCGAGAGTGTCGCCATCTAGAAGCATCTCTCGCGCGTCTTGGCCACGCGATGGTGAGTGAAGAACATCTTGTAATGGGAGCACAAACGTT
GTCACCAGCTGTTTTCGAGATCGAATGTGGATGCTCACGAGCCTGCACACAGAGATACATCACATGCATAAACACACAACGTAAGGTGATGAGATGACCC
GGAGATTCGAGTAGCTAGGAGCTGTGATGTCTGTACCAGCAGGACAACGAGCTGATGAAATCGAGTTTGTTAGCGTCGATCCGACACATCAGTTTGACGG
CTTTCTTGTGCAAAAGCGCGCCTGCCGATACCAGCGATAGTTCCAGGTTGCAGTGGAAAAGCGAGTGGGTTCCTATACACACGCAATACACAGACAATAT
GTCAAGGCGCATATAAATGGAGATTAGTGATTGTAATATCCGGCCTCAAAT