Description :
From Genome Similarity Track
Location :
contig_12:729655- 730671
Transcript NameFunction/comments
g3288.t1hypothetical protein

Sequence
1016 bases(100 bases per row)
GAGGAATGGTCCTTGAACAAGACGAGTTGGTATTTCAACGGCAAGATGTACCAGAAGTACGCGTCGCTGTGCCTCTTGGCCGCGGACGCTGCTGTCGTGG
GGAAAGATAAAAAGCTGCTCAAGACTTGCCTCACCAAGCTGGAGACGCTCATCGAGCCCTTCCTGAACAACACGCTCGCACCTGCTCTCAACTATGAGAC
GTCGTACGGTGGTCTCGTGAGCAGCCTGGGGTTCACCGTGAACGACGTGAACGCCGACTTTGGCAACACCGTGTACAACGACCACCACTACCACTACGGC
TACTGGGTGGCGGCTTCTGCCATGCTCAAGAGCCTCGACCCCAAGTGGGCGCGCATGAAAGACCTCGACTCGATGATCTGGATGATGCTGCGCGACGTGG
CCAACCCGAGCTCCGAAGACGCCTTCTTCCCCAAGTTCCGCCACTTCTCCTTCTACCTCGGCCATTCGTACTCGCACGGCGTGACTCCGATGCTTGATGG
CAAGGACGAAGAGAGCACGTCCGAAGACGTCAACTTCTACTACGGCATGAAGCTCTGGGGCCAAGTGTCCAAGAACAAGGCCGTGGAAGACCTCGGAAGC
CTCATGCTGCGCCTCAACGCGCGCGCCATCCGCACCTACTTCCTCATGACGTCGGACAACACCATCCACCCCAAGCAGTTCGTACCCAACCACGTGACGG
GCATCTTCTTCGACAACAAGGCGGCGTACGCGACGTGGTTCAGTGCCGAGAAGTACGCCATCCACGGCATCCAAATGATCCCCGTGTCCCCCATCAACGC
CATGGTGCGTACTACCAAGTTCATCCAGCAGGAGTGGGAAGACATTCTGTCCAAGGAGCCCATCGTCACCGAGGCCAACACGACGAACGCTTGGCTCTCG
CTCCTTCTAGTGAACGAGGCCGCTGTGGACCAGGAAGACGCACTGACCAAGCTCCAAGACGCCACCATGGACGACGGGCTCACCCGCTCGTGGGCATTGT
ACAATGCCGCCTCGCG