Description :
From Genome Similarity Track
Location :
Scaffold_102:72961- 74257
Sequence
1296 bases(100 bases per row)
CATAATCGGAACGGTGAGATAGGGCATCTGCCAGTACATTTTATTTCCCCGGGTTGTACTTCGTCTCGAAGTTATAGTCCACAAAGAAATAAATCCAACG
AGTCATTCTGTGAGATAGTTGAGGCGGCTGTGTCGCCGTGCGTAATGATGCATGATCCGAGTAGACGATGAATGGCTTGGAGCCAAGTAGGTAAACTCTA
AATTTGAAGGGAGCATACTTCATAGCAATCAAATCTTTATCATGAACGGGATGGTTTTTCTCAGCAGCTTTAGGCTGACGAAATTCAAAGTCGACAACTC
GCTCAACAGGGTGCTGCCTAAGGCCAAGTTGGATGCGTCGCAGACGATACTAAAAGGGTACTCAGGATTTGGCATAGCCAAAATGGAAGCATGGAGAAGA
CTCTCCTTTACTGCTCGAAATGCGTTAGTATGGATGTTGACCTCAGCGCCGATCTGTGTCCTCCTTAAGAAGATCAGTTAATGGCCGAGCCATTTTAGCT
TAATTTTCGCTATATTTGTGTAAGTAATTGTCAAGGTCAAGCCACTTACGCAATTCTTTTGATTCTCAGGAATCAGCCAGCCAACTATAGCGTTGAACTT
AGAGGGATCTTCTCTAAGGCCGCGCTTGCCAATGAAATAACCAAGAAAGGAGTCTATTCTGCAATAAATATTTATTTAGACGCGTTGGCGTACAATTTAT
TCATGCGCATGCAGTCGAGCACGGCTCGCAGATGACCGATGTGGTTATCAACATCCGACTGACCCTGTTCCGCCAGACTATGGATAATTATGGCATCAAA
TATGTCTATGCATATCCGATGGGGACGGGAAAGTTGTGTCACCAGACAATTAAATGTAGCCGGTGCGTCAGATAGCCCTTGGGGAATCACCAGACATTCC
CAAATCATACCACTCGACGGGCTCACGGCTGTCAGCGGAATATCACTCGCTCGCATGATCAATTAGTAATATCCATCGACTAAGTCGAGTGCACTATACA
CAGTGCAGCCAACCGTGCTGTTTAGAGAACATCCTGTCGAGGAATGGGTGTTTGTGCCGGTATAGTGGCCGCATTAAGCTTGTTATAAGCATGCACAATA
CGCCACTTGCCGTTCGTCTTTTTGACACAAAATGTCGGTGTCAAATGTGGAGATTTACGCTCACGTATCATTCCTGCCTCGTGCTTGGCACGGAAGAAGT
CCTCAATGATATCGCATTGCTCCTTAGACAGGGACCACTGTTGTGTGACACAGTATTTGGTTTCAGGGACCAAGTCAATTTCATGACGTACGCCCT