Description :
From Genome Similarity Track
Location :
Scaffold_141:7296- 9493
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_141-fgenesh-gene-0.1Lysosomal beta glucosidase

Sequence
2197 bases(100 bases per row)
ATCCGAGAGAAAGCGGCGCAGATGACTCAGCTGGACATCTACTCGATGGTGAACGGCGACATTCGCGACCCCGAGAAAGCGCTGAACAAGGACGTCGTGA
CCAAGTACGCCAAGGCGGGCATCGGCTCGATCCTGAATGCGCCATTCAACGGACGCATCACGGACGGCCGCACGGGCTGGAGCGCTCCCGAGTGGAAGCG
CATCATCGAGCAGATCCAAGCCATCTACCGCGAGCACAGCCAGACACCCATGATGTATGGCATCGACACGATTCACGGCGCGACGTACGTCCGTGGGGCG
ACTCTATTCGGACAGCCGATCAGCGCAGCGTCGTCGTTCAACCTGGACTTGGTGTACAAAATGGGCGAAATCGAAGCGAAAGACACGCTGAGCGCCGGGA
TCCCGTGGATCTTCAGTCCCGTGCTGGGCATCGCCGTGCAACCAAAGTGGGCTCGCGTGTACGAGACGTTTGGGGAAGACCCGCACCTGTCGTCGCTCAT
GGGTGCGTCGATCATTCGCGGCATCCAGAGCACGGGCAAGGTCGCTGCATGTATGAAGCACTTCATCGGATATTCGAACCCGACGTCGGGCTTGGATCGG
GCAGACAACGTCATCTCGGACTGGGACCTGGTGAACCACTTCGCGCCGTCGTTCTTAGCTGCGGCCCGTGCGGACGTGAAAACCGCCATGGAGTCGTACA
TCTCGATCAACGGGGTGCCTGTAATCGCAAGCCGCAAGCTGCTCACGAACCTACTGCGCCACGACATGAACTTTGCGGGACTGCTCGTCTCGGACTACTC
GGAGATCGACCGGATGCAGCAAGAGCACCACTTGGTGCCGACTGTCGCGGACGCCGTGCGCGTGTCGCTCTCCGAAACCTCGCTCGACATGAACATGGGG
CCAAACATGGACGATTTCCTAGGAACGGTTGAGGGGCTCGTGAAGAGCGGTCAACTTCCTGAAAGCCGCCTAGATGAATCGGTCTTGCGAATCCTCTCGC
TGAAGAAAGACCTCGGACTGTTTCAGCAGCACACTGGCGATGGTGGTGGTGAGAAGAAGAAGTCTGAGACCCCGGTGCTGTCATCATCATCATCACCGCC
TATGTCTGAAGTCGGAAGCCCTGAAGACCAGGAAATCGCGCTGCGACTTGCGCGCGAGTCGGTCATTTTGCTCGAAAACCGCAACAACACGTTGCCGCTG
CGCATTCCTTCACCTTCAAGCAAGAAGAACACGAGCATCTTCATCACTGGCCCGATCTCCAACAACAAAGGCTACATGTGCGGCGGCTGGTCGGTTTTCT
GGCAGGGCTCGTCGAATTCGTCGTATTTCCCAAACGGCAAGACGTTCAAAGACGCGATGTTTGAGAAAAGAAGCGAGCATTTGCACGTGCAGCACTTGGA
TGTCGTCGATGTCGATGGGCACGTCTCGGGTGAAGAATTCGGGAAAGCGCTGGAAATCGCGTCCGAGAGTGACTACACGATCGTGGTGCTTGGCGAAGGC
AATTACGCGGAGAAGACTGGCGACATCGCAGATCTCTCGCTGCCGTTGGGACAGCGTAAGTATCTGCACTCGCTCACTCAGCTCAAGCACACCAAAGTGA
TCGTTATATTGGTCTCTGGTCGTCCACGACTTCTTCACGGCGCGCATGACGGCGCTGCAGCGGTTCTACTGAGCATGTTGCCCTGTGAACAGGGTGGACA
GGCACTCGCTGATATCATCTTTGGCGATGTGAACCCGTCTGCGAAGCTCCCAATCACGTACCCGATAGCTGACGGCAAGATCTTACCGTACTTTCACCGC
GTGAACACAATGTGCCAACCCTGGGACGAGTGCCCGGTCGAGTGGGAGTTTGGCTATGGCTTGAGCTACTCGCGCTTCAAATACTCGAACCTCACGCTGA
GTGCGACCCACGTGCAGGGCAAGACCGGGAAGCTCCACGTTCAAGTGACGCTGGAGAACCCGAGCGACCGCGAGGGCAGCGAGGCGGTACTGCTCTTCGT
CTCCGAGAAGTATCGGTTGGCGGCGGTGCCCGAGAAGAAATTGCTCAAGAGATTTCAGAAAGTGAAGCTCGCAGCGCACGCGAGCGTGAGCGTGGAATTC
GTGTTGGTGGAGGAAGACTGGAGCTACTACGAACCGCATATTGGCGGCGGCTTCAAGAGCCGCTTTGAAGCGGGTGAGTTTACAGTTTCCATTTTGC