Description :
From Genome Similarity Track
Location :
Scaffold_14:72931- 83686
Transcript NameFunction/comments
Phymu_g1016hypothetical protein
Phymu_g1017nucleolin, putative
Phymu_g1018conserved hypothetical protein
Phymu_g1019conserved hypothetical protein
Phymu_g1020conserved hypothetical protein

Sequence
10755 bases(100 bases per row)
GCTCTCATCTGTCTGTAGGCAGACACTGGCGTTCAGCACCTCGCAACTGCCAATTGGCGCTGCGCCTTTCGACCATCAGTTCGCCAGCTCATCTGGTCGC
CAAGCTGCAACGGCTCCGTAGCTCGCCATGGCACTCCGTAAGTCCATTTCGCTGCCGATTGTGCCGCCAGCCAAGCTGCGACGTCGCCAGTCTCTTCGGG
ACGAACAAATGAGccgctcgttctcgttcaccAAGCGCCGCGTCGAGAGGCAGACGTCGCGCCTCACTCCAACGCAGACGATGGAGCAGACACTGCTGGA
TAACGTGCACGTGGAGTTCGTGAAGGCTGTGGTGCCCGGCCAGAACAAGCTGGCCAGTCCGCGTTACGTCATGCGCATCAGCAACACGGCGCTCGACCAA
ACGTGGGAGATGGCGAGAACGTTTAAGGAGTTCTACGAGTTCAAAGAAGCCATCGCCAGTGTGCTCGACTACGGCCACTTCTGTCCGTCAAACTGTCCGT
GGCTTTACATGTACGCGGCGCATCACTTCCCACGCCGCCGCATCTTCCGGTCACGGAGTCCGAGCGTCATCTCTGGGCGGCTGTCGGAATTGCAGACGTA
CTTTTCGACGTTGCTGCGTATGGCGAAGCAGAACCGCAACTTGGACTGCGCAGTGTCTTCTACCAAGCTACCGAGACTCATCTACGACTTCTTGTTCGAG
GGCATGGTCTTCGATCGCTCCGACTTCACGAGGTTGAGCGAACGACTCTCTATGGGCGGACGAGATAGCAGCTTCCTTGACAACGACCCGACACAAGATC
CAGAGGAATGCTTTATCTGTCGCAAGGCGCTTGTCGGCGACGACACCGTGTCGATTGTGCCAGctgcaccaagcagcaaacgGGGAGCGTCAAACGTCGA
CAAGAAGGTCGACAAGCATGTGATGGCAGGTCTGACAACGCTTGACTGCGGCCACTGCTTCCACGACGAGTGTATCCTCGCGAAACTCAACGAGTCGCTA
ACTTGTCCACTCTGCATAGCGCACTCCAGCCCACCTCAAAGCAGAGTTCTTACTGCCTAAGGCTCTACAGTAAGTATTGTAGCAGACAATTAACGTAGCT
CCGACAACCCGTCGCTCATGTTCATAATGATAAGGTGACGGCTTTATTCAAGTGGTCGATGTTGTGTAGCATCATGCCAATTAGCTTTGCTGTAACAAGT
CTTTAACATTCAATGTCTGTGGCTCTTCTTACGTTTTCTCGTCTACAGGACAGCATGTACACTGGGGTTAACTGCAGCATTTAATAAACCCTTTCActaa
aatggctacacttggAGTGCACCACATAATGTAGCCCGTTCCACATTCGAATAGCCAACAAAATGCAGCGCAGCCGAGTCCGCAACCAGGAGGTGCGTCT
TCCTCCCTCTCTTGTTCTTCCCACCCGAGCTACCGCTTTATCACCTTCTACACACATCTACACTCGCTCTCTAACGTTATGTACTGCTGTTTCTATTGAG
ATCACGCAGGTGACAGACGCACAAGGCCGGCGACGCTTCCACGGAGCCTTCACGGGCGGATTCTCAGCTGGTTACTACAATTCTGTGGGCAGTGAGGAGG
GATGGGCACCCAAGaccttctcttcttctcgtggcAACCGCTCAGCACGTATTGAGCAGCGTCCTGAGGATTTtatggacgaggacgatgatCCTCTGCT
TGGCAAACGACTGGAGACCACGGAGCGCTACGACACGCTGCAAACAGGAGCTAAGagacggctgcagcagcaaccagccCCAACTCAATCTGTTGCTATC
CCAGAGTTCTCATTGCCAGAGGACTGGGTTTTACCAGCCGATGACTCCATTGGAGCAACACTTTTGAAGCAAATGGGATGGAAAAAGGGTCATGGCATTG
GACAACGAGTTCGAAGACACAAGtaccaagaggaagagaaaaaTGATGTGGAGGCGCAAGATaaggctgaagaggaggtgTATGTTCCGTCACGAAAGGT
TTTTGATGTGGAAAAAGCGTTTCCGAAACCCAAACTGGATCGATACGGAGCAGGCTTTGACCCATACAGAGATGCCCCAGAGTTCTCGGTGTataagcag
cagcaggagcagaagctgaaagaGAAGGAGGGATCTCATCGACAGGTCGTTTCGTTCATGgacgcgttgaagacgagcaacGGCAGCAATCGCGCAACAA
CTGGGTATGGCCTGAGCTCACTGGAAGAGAACGACGATATTGACGTGTATGGAACAGTTTCGATGGCTGAGTTTGATCGGGTTATCGCACCACTTGGAGC
AAGGAAGGACGTTAAACGCCTGGGCTCATCAGCACAAGATTCACGGCGGCATGAGAAGCGATGCAGCCGAGCGTTGTGCTCTGATGGACGGCCAGTGCTT
CCAGGTTTCGAGCTGGCGAAATCCAAAGAGAAGTTACCAAAAGTAGTAAACCTACGGCTGGTTGTGCCTCCCGAGTTTAAGGCGTATCACCACTTCAAAG
ATGGTGACGGCGAGGATGACGCAGTGACAGCCCTGTACCGCAAGTACAAATTTTCGACAGACGCTACGAGCTCTGGCCTGGTCGTTACAGCGAAACAGCG
AGGTGTTCTACTCGGAGACGCTAAGCAAAACGCAGCAGGCAACGCAGGTTCGacagctgctggtgaagtGAAAAGCTCAAGTGGGAGTGTGTTTGATATG
CTGGGAGAAGACCAAAGAGCAaagcttcttgatgctgtAGCTCAAGCAAAGCAAGGTTTACATCGGGCGCATACTACGACAAAGGAAGAACCGATAGCTC
CAAAAACTCGACAGGCTTTAGTGAGTGGCAGTGATGGCGATCATTTTCGTGAAACGATCTCTGCGTCTATTGCAAAGAGATTTGTGTCGGCGAATTCCAC
TTTGGAAGGAGATAAAGGTGgtgctcctgctgcaaaaGAGCCCCAAGCTAATCTGTCGCGTCGGTCGCAGAGCTTATGGATCCCTAAGTCGCTGCTCTGC
AAGCGCTTCCATGTGAAGTGTGCCGGACCGACGGGGGCCAATGGAAAAGACGAGGAGAAtgacaagaagcaggactTGTTCGACAAGGAGCTTGTTCCAC
ACTTGATGGAGTTTGCTGCCGATCGAGCTGCCCACCAGAAGTCAGAAAATGAAGCTCGTGAGACGTCAAAATTTACTGCGGGTGTTAAGCATGCAGAGGA
GGTAGCTTTGGTGCTATTACCCCCAGTCGAAAAGGCATCGACTGATCTACTCAAATCCATTTTCGAGCCGTCGGACGAGTCAGAAGTCAGTGAAGACGAT
AGTGAAGatgaaagtgaagacgaaagcaGTGAGGGGCAATCCCCACAGAAAACCTCTTCACGTGAACACGCAAATCATCAGCGAGATCGACAAGGGAGTT
CCGCCGAGTCGAGTTCATctgacgatgacgatggccTCTCTGCTTCCGTGAACGAATCTAGGAGTGGAGACCACCAAGGCGCTCGAAGCAACAAGCGATC
TCACAGTGCTGATGCCACCGCTAGTCACGATGACGGGCAgcaagtggaggaagagagaCGGAAGCACAAGAAACACAAGAAACACCATAAGCACAGCTCG
TCCCGAGATGAAAGGGGtaagaagaggaagaagggCAAAAAGGAACGCAAGGAGCGAAAGCCACACAGTCACCGGTCATCGAGACACTCGAGGCGAAGTC
GGAGTCCAGAACGCAGTTCTCATCGCCATCGTAGCTCCAGCAGACGGCActgataccggtacatgcaTGTAGTAATGTTAGTCGACTGTTGAAGTTGGTT
GACAGCTTTGGACATTCTTTCGTGATGGTAATCATCTCAAAACTCGAAGAAAACACACTTTAAAGTCTATGTAAACAGAATCGATTGAAGCTCAAAGCAA
TGCAAAACTAGTCAATACACGACAGAGAGCTCCGGCTGTGCAGTCCCTCTACCGAGTCAAGCACCCGTTGCCTGGCGCTATAAGCACAAGTGTCTCCCTG
AGGTCGCATCCCTGACCTATGTGAAGGTTGCCCCATTAAATTAGTCGAAAGTCATCTTGTTACCCTGGAAGTTCTGGATGGAGGTCGACTGGCGCTTAGG
CGGGCCGTCACCGcgaccaccacgtccacggccaccacgaccaccgCCGCGTCCACCGAAACCACGGCCGccgccacgaccaccgaagcCACGGccacct
ccacgtcctccatcgAAACCACCACGGCCTCCACGGCCGCCGCGGCCACCGCCACGTCCACCAAAGCCACCGCGGCCACCACcgctgtgctgctcacgCG
ACTTCGCGTAGTTGACACGGATGGCACGGCCGTTCACGTACGAGCCAGCAAGCTTGACGGCCTCGTCAACAGCCTCAGTAGTTTCGAAGTCCACGTGACC
GAAGCCACGGAACTCGCCAGTCTCACGGTCCGTAGCAAGACGGCAGCTAAGGATCTCACCGCACTCCCCAAAAGTCTCACGAATGGTGTTCTCGTCCACA
TCCCAAGAAAGGTTGCcaatgaagacgctggtgcaTCCCTCCGGCTTCTCGTCAaacatgttcttcttctcggccgTACGGATCTTCATCCAACGACCAC
CGAAGTCCTGTCCGTCCATAGCAAGACCAGCCTCAACAGCCTCAGGGGTAGCAAAAGTCACAAAAGCAGTACCAGAAGAGCGGCCGTTCTGCATGGGGAT
ACGAGCGGCAGTCACCTCACCGCAGCCAGCGAAGTGTTccttcacctcgtcctcagTGGCAGACCACGGAAGGCCAGCAATGAAGATCTCCAGAGTCTTC
TGGGGGTTGgccacagcagcggcatcgccgttctcctgcttctgcacCTTGTTGGACTTCTCACCAGCGTCCGAGTTTTTACGCTTCTTAGCGACAACAG
GggtctcctcctcgtcagAAGACGAGTCCGAGTcgctcgacgacgacgaggactcctccttcttggcagcagccttcttggcAACAGGCTTCTTagcctc
ctcgtcatccgacgagtccgagtccgaaGAATCCGAGGagctctcctccttcttagCAGCAACCTTCTTGACCGGGGCGGCCTTCTTAggcgcctcctcc
tcatccgAAGACGAGTCCGAAGAGTCCGagctctcctccttcttagcagccaccttcttgacaggcgcagccttcttcttcggagcctcctcctcatccg
AGGACGAGTCCGACGAATCCGAAGagctctcctccttcttagCAACAACCTTCTTGGCAGgagcagccttcttcttaggagcctcttcctcgtccgagcT
CGAGTCCGAAGAATCCGAAGagctctcctccttcttagCGACaaccttcttggccacgaccttcttggccacgacctTCTTGGGagcctcctcttcatca
gaaGAAGAGTCCGAAGACGAGCTGTCCGAGTCCACGGGCTTCTTCGGGGCGGCCTTGGAGCCCTTCTTCGCCACCACAACCTTCTGCGGCGcctcgtcgc
tgctcgagtccgacgagctgtcgctgctggacgcagGCTTCACTTGAGCtttcaccttcttggccattgTATCGAATTGTAGAGGAAAACCGACgcgtct
ggagctgttgaacGATTGCCAAATGACCAGCGTAGAACTCCGGTGGCTTGCAAGCGCTTGATACCTTCAATCTGCGCACGCAGTTTGGTTGGCTGTGCGA
ATGCatggtacagtgtaccgCACAACACATTGTGTGGTGTACATGAAGCCGGTGCCAAAGACGTGTGTACGCCACACGAGATGTGTGGCGCACAGCTATT
TGAGGTTTTTTCCACGGAATAGGAAGGGGGGCGAGGTTTTTGGTGTTTCACTTGTGGATCGCGCCACATCAGACCACACCGCAGTCTTTCTTTCGAATCG
ATCCGACCAATCCGCGCCAAAGCTGGTGACCTATACTGTATTATGGTAGCAAGCGGTGCCGACGAGAACTCGCCAGTGGACGACGCTGCGACGcaagtgg
tgctggaagacgtggacaAGGTGGACCACGAGACGATCGTGGGCGAGAAGCGCCCGCGCGATGACGATGTCGAGTCCCTCGTGCCGAATGTGGACGCTGT
CCCGGACTCCGTTGTCGATGATGCCTCTGCCGAGTCTGTCGACTCTCAGGCCACGCACAACGTCGTGGatctcgacgtcgtggccaagatgaaggaaGCC
GTGGGCGTCGACGTTGCATTCGACGCTGCCGCAGCTGCCGCAGCCGTCGTGCCGCCCCCGGAGGGACTCAAATCGGAATCGGCTACTCCTGTCCAAGATG
CggtcgtggctgcagctgctgctggcgttggagctgACCCGAACATGCCTACGAACGTCAAGTTTGAAAGCAAGCGCATGGCCCGTGTGTCGTTCAATTC
GTGGTTCGACTTTGATTCGTACTTTGAAATGTACATGCAGGAGACGTTCCAGCCCTTCCGTATGCGATCGTCCTGCAGCGTGGACGCCTACCGTcgcaac
cagcagaaggTCATGCTCAACAATAAGAGCTCGCGTGGTCGCCGTGCTGAGTTCCCTGATGAAGCCATCCATCATCACCGGATATACATGTGCACGCACG
CCATGAAAGCGAGGTGCCGCGGCGCCAACACCCGCCCCGGACAGAAGTACCGTGGCATCGGCTGCATGGCCAAGATCAATGTCAAGATCACCCCGGCCGA
TAGTCCTTCGAAGTACATGGTCATCGTCACGGACCAGGTAAGATATGCTGTGCTTTGGCTCTGGTAGTATGAGTCAGTACTGACTCATGATCCGTTAATC
GTGCTACATACAGGTTGTCAGTCACAACCACCCAGTAAGCCGCGAGATCTACGAGGCGTACCCGGACGTGTTGCTTAAGATGATGCGACGCAGCCAACTG
ACCCAATCGATGCTGGGCCACCCGCCTCCGCCCAAGTTCGAGACGCCtcagcagacgcagaagTATGAGCGCGCTATGAACACGTTCCAGTCGGTGGCGG
AGACCATGGCACGGCTgagcgacgaggactacgaggCACAGCTTggccagctgcagcggctctACACACCCGCAGCGGAGCAAGATCAAACGGTCTAAAG
TAAAAGTCAAGCTGCCTCTGCGCATCAAGGATCCTGTTGGTGGCTATACATTACGGGATGAGAAGAAAAGCTGTCAAGAGGAACGTACCAAGATGATGAG
CGAGCAAATTTCAATTCCTTGTTCAGAccgattttttttttcattttttcATCAAAAATGCAAATTTGTTTGTTCTTATTCTGTCAACAAATTATAATAT
TACATGTACTCAAAttacaaaaaaaaatagtcGTATCAAATTAGGGGGGAACTGAGAACAACGAGCGACATCTGCACTCATAGCGCGTAACCTTCACCGG
AGCGATGGCGAGTAGCGGCGTGGATGTGGCCCTGGCGCCCAACTCTAGCGTGATCTTGGAGCCAGCGGACTCGCTGTCCTTCCACCTGCAGCCTCAGACG
GCGCCCCAGGCGGTGCTGACGATCCGCAACGTGGCGGATGACCGACAAATCGCCTTCAAGGTCAAGACCACGCGGCCTCTACGCTACCTGGTGCGGCCTA
ACCAGGGTCTGCTGGGCCCCAATGGGTCGGCCTCCATCATGGTTATCTTACAGCAGAAGGACtgcgacgagctgctgcgcctgGACCCAGCCGAGCGTCA
ATTGGCTAACGACAAGTTCCTGGTGCAGAGCatctacgtggacgacagTTTCTATGAACTTGTGAAGACCAAGAGCACGAAGGAGATGGCGGACGAGCTG
ACTAATATGTGGGCGCGCACGGATAAGCGCGCGTTGTCCAACAAAAAGCTGCGCTGTCGCTTCGTGCAGGACAGTGAGGATACGGGACGTCCGGTTTCTC
CGCCCAGTCCGCAGCGGGCGCCATCGGCTAATGCTTCTCCTGCTAAGACAGCAGCTACGTCCGACACGAGATATCAAACTAGACAGAGCGACGAGGCCAG
AGAGGAAGTGGCTACACCTGCACAGCTTTCGTCTGCATTGCTGCAGGATGACAAGCCCCAGGCGCCTAAAGTGGCGGAGAACAGGGAAGGAAGCAAGGAA
GCCATCCAGGAGGTTGCTGCACTGCGCAAGAAATACGACGAGGTACGTGGTGTTTGTAGATAACGTGGTGGTGTGACGTAGTGGCTGATAATTTTGATGT
GAACGCTGTAGTTGGTGGCATTTACAGTGCAGCTTACGGCGCAGCGTGACGTGTTGATGAGCGACCTGGACAAGACCCGACAGCTGCTCCAGAAGGCGAG
CACGGATGCTCagcgcgtgaagaagctttcaGAGGAGTCGACGGGCCTGCGTCATCGGAAAAATGGTGGTGCCACTGGTGTGTCTGGCAGCGAAGACTCG
CAGGCGATTACGAGCAAGGGACCGAATGAGCAAGGGGtacgtgttgctgctgtcagTGGCATTGGGGGATTTCTTTGGCAGGTTATAACGGTCGTTTTGA
CAATGTGTCTGCAGGCTTTCGGACCGTTGCATCTACTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGTCGACTGTTGCTGAGTTGG
GTGCGCTGGAATTTAGGCAAAGACGGAGGGTGCTACACTTCAGACGTGTGACGAtagaggaagcagcagtacggGAGCATTAGAGCTTTCTGTCGACAGA
CGCTGATCTGCGTTCGCTCGTGTGTAAGTAGGCTAGTAGTACGAAAGTAGTTGGAACACTTGGCGAACTGGGGACAACAAGGCAAGACCACGAAACCAGG
GAAATGAATGAATATGGCAACAACCCGTTGAAAAATGGCATTTTAGAAAATCGGTGGTGCATTTGATAAGCGGCAGATGGACCACATCTGAACGTCCAGC
CTTGATACAACAGTAACAGGCATCCTGTAGAGCTACTGACCTACGCGTAATGATGCTGGCTAGTTCAGAATCGCAGTGACGCTCATTTTGCGCTTGCCTT
CCATATCTAGCGGCGCACAAGCTTTGCGCTTCGCACTCCGAGTACGGCAGCTCTCCGTAGCACTGTCACCACCATCGCTGCTGATTCCAGATGGGCGCAG
ACCTGCACTATCTTTCATAGAAAGCATAGCAATCGCTGCGGCATCGCTGTCGGACTGGGTACTGGCTGGAGCAACGCGCAACGGCAGCGGAGGCACAATG
TTGTTTTCTTCCTGAGGTCGCCCACCAAAACGCAATGGCGGCACTTCTGTATCATCGTCAGGGAAGGCGCTGTCGTCCGCGTTGTCCTCGTACTCTCCGT
CGCCGTCATACGCACTCTCAATCTTTCGGAGCTCCCGCACATCATCTCGAAGCGCATTCACTCGAACTAGCGTCACCGAATCCTCAGACCTGGGGGACGA
GTCATCCACAGCACCTCTATACCTGCGTCCGTCGTGACGACCACCGCTTGCACCGGGCGGAGTGTGGCTTGGCGAGTGGTTCGGTGCGTCATTGTTGCCG
AAGGAGGAGTTACCACCACTAGCGCCACCAGTGGCGGGACCTGAGCTGCCAGGTGCCTCCCctgaaggcgacgatgacgagctgccgccaccaccacgtc
gagaagaagacttTTGAGCGTCATGCTGCTCGATGCTTGAGCCAGTTGCCTGCATGAAAATGTGCTCCAAACGGTCGATCATCTGCAACAGCGGCTCGTA
CGTCGCGAAAGGTTGCTTCATCAGGATTGTGTGCATGAACTTGTTGCGTGTGGCATATCCCGTCCACTTATCGTGCTTTTTCAAGATCTGGAAGACAAAA
GGCACATGGAACAAGTTAGAAGAAGCTTCAAACAATGCAATACGGATGGAAATGCTGCCAGGGGGACGAACCGCCTGCCTCAGCGTAAGAGCGCAATGTG
TCTAGGATCCGACCTTGGAAATGCCGCAGAAGTTCATCACTGCAAAGttctccaacagcagcaactcctTGTACAGCGcgacgcagctcttcatgaGTGC
CGTTTTGGCTTCAGCTGACTCGGGGTTCGTCTGAGCAGCGCACAAAACAACGTTGTTAGACTTTTGTACCGATGATTATCGTGTTGTACAACCTTCCAGC
CATCAACAAAGCTCCTACCTTtaactgctggaagctggcgTCGATGGCTGCCACTTGGCTTGTGTGTTTAGCCTGCTCCTTAATGAAGAAGTCGGCGATC
TTATTGATCTCCATACGCAACGTCCGGAAGAAGTTCATTTCGTCCTGCGACTGACCTGTTGCCAGAAAGACAATACGGTCAATATCAAACCTCAATTCCG
TCGAAAGACGTTCATTACGTACGGATGCTGTCGTTGTCCTCCTTGGCAGACGGCTTGATCTTAATCTTGACGAGCTTGTcgccctgcagcttctcctcct
tcttgatctgcgcGCAGTCCttgatgatcttcttgagcagcttgtagTCGGCCCAATAGGGCTCCCAGGCACTGGGCGACATTTGCGtcgactgctgcag
tacttTGCCGAACTTCATCTCTGCGTCAGGTACTCCGGTCTAGTGTCCCGTACTGCTTCCCACTTGACTTGTAAgtgtgcgtcttctgccCTCGGTCTGA
CAAAAAACAACTGATAACCAACCAGTCAGGCCCAAAGCAGTTCAGCGCACACACTCTTCCTAGGCCACGCAGTGCAGAGCGCAGTGGAGCGGGGCAACTG
GCGCGAGATTCGATGCAGAGACGAGGAGAAAACACCTGCTCGAATCTTTCAGTCC