Description :
From Genome Similarity Track
Location :
Scaffold_25:7291- 11357
Transcript NameFunction/comments
Physo_344668unnamed protein product
Physo_537464predicted protein

Sequence
4066 bases(100 bases per row)
GTTGAGTTCCGCCAGCGCCTCGCCGACCAGTAGTTCAGCATCTCGACCCCCTCCACGGTAGCGTAGGATTCGCAATTTCTACTATGTCACAATTTTTAAA
ACGAGTGATAAGTGATATGGTAGCACTTAGAGAGGAAGTACGGCGGCATCGGGAGTCAAGATGCTGTGTTGAGTACGCTGGAAAATCGAAACTGAGATTG
AGTTTAGCACCTTCGTCCTATTCCTCCTAAGCAATTATAGTCCTTGGTGCCTGCAACTTCAATATCTAACTTCAAGCACATCGCTTCCTACATCTTTAAC
TTCATCCAGATGACTGCGTTGCACGCAGGTCACACGGCTTACTGCAGCTTGATCTCCACAAAGTTGGCAGATCGTTACCCGTTTTCGCGCTCTATGTGTT
TGTAGTCGATAATATCGTGACAATCTGGTAGTATACCTTCCTAAAATTGATAAGTGCTCAATTCAATAGTATACGGTACACAAATTGGCGCTATCCGTTA
TTAGCATTTGCTAATCGCCCTGATAATTCCTAGTCTAAAATAGAGGTGGGGAATCTAATTAGGAGATCAGTCGAAATAAATAAGACTTTGGAGTCTAAAT
TAGCCAAGACCTCGACCAATTTACTATCCGATTAGACGTGATCGCAATATATCAATTCCTGTATACAAATTCCTGAAAAAGCAAGCACGTTGCCACATAA
AAACTTACGGGATGACTTGAAGCGTCGCCTTGTCACATGTGGCGCGTCCTTTCATGGCCACTCGATCTAAGTAGCAGCTTCCGGTGCAGAACTCAGGTTC
ATGACCGGCACGAAGGGCAGAGGCCGGGGCTCCGTGGCCGCGCGGTATGCGCGCGCCAACGCGCTGGTGGGGTCCGTGCTGAACAAGTTCCACAATGGGT
CGGAGCGGGCGGTGGACCCGTTCGTGATCCGCACGCTGAAGGAGCACGAGCCGCGGCTGCTGGGCATCCGGTGCTTCGTGGAGCAGGTAGAGTACGCACA
ATAATAATAAGCTTATCCTTCCTGAGGCTGCGGGTTGAAGACTGAAGCGGGCGTTGCGCAGGGGCCAGCGGAGGACAGTCGACGCGCCAAGGACGAGTCG
CACGTGGTCAACCACACGACGCACGCGTCGGGCATTTTCGGGCTCTTCACAGTCTGCGGGGGGTTGTTCGGACCGGGGGTAATCATGTCAGTGCGGGTTT
TGTGGCGGGAGCTTGGAGGTGGAGGCTTATCTACTGTGAGTTTTGTGCTTTGACAGGCGTCAGTGGGATGCGTGCAGCGGAACGGAGGGCGACACGGACG
AGCGGGAGGCCGCCATGGCGGAGTACGTGGCTACGGTGGACAAGATGCTGCCTGGGTGGGACGAGAGCCTGCCGGACCACCCCGTTGCCAGCACGGACCG
CTTCTGGGAGGACGATGCGACGGCGACGAACTGTCCGCTGTGCTTCGTCGCCTTCTCCGTACGCGAACGTCGTCACCACTGTCGGTTGTGCTTCTCGATA
TTCTGCGCGGGCTGCTGCGGACAGATCCTGGAGGTCGCCTTGTGTCCAGGCGCGCCGCTGCGCGCGCAGCGCGTGTGCACGCCGTGCTATCAGGCGGAGT
ACCGTGCCCAGCAGCTTCGAGAAGCGAGGAAAATCAGCCGCGAGAACCAGGAACTCGAGCAGAGGATTCGCGCGGTGCTGTCTACAGCGAAGCAGACACT
TGCGGCCAAGCAGCAGGAGGAACAGAAATTGCGCGCGCTGGCGATTGACGCGGGCTGCGACGTACAGGCTCTCGATGAGGCTATTCAGAAGCAGCACGGC
GGATCCCCCATAGGCTCCGCGTCAATGGAGCTGCGAACGCCGCCAGCAGCGCACCGATTCGCACCAACGCAAACCTCGGTGGAAGCCTCAAACCAGCTCG
CTCTGGCTCATCGGCAACTAACGATGAGCTTCAAGATGGCGCAATGTCGTGCTCATCGGGTGCTCGACAAGATGAACGCAACAATCGCGGCGTTGCGAGA
TGCTGTGAACACTCAAAAGTCGACGAACAACAGGTCGCCATCGCCTGATCATGAAGACAACGGATGGAGCGCCATGATTCGCCACACGGACAGTTTCCTC
ACGCAAACCGATCGGGAGGCGCTGCAAGTTGTTCCGGATGAGCTCTACAGCCGTTTACGCTCTCGAAGTAGCAGCTCCGTTGACAACTCGGCTGCATCGG
ACCAAAGTATTGCCATGCTGTGGCAGACGGAGTGTCTGAAAGATAATCGGACGCGGACTTTTGTCACAGACTTGGCTGAAGCTGTGCGTGCCAGGCTAGA
TGCTTCGTCAGGGTCAGATACTGAAGACTCGGACGCGAATGAGGCACCCGTGGCCACGTCACGTCCGTTGTGGGAACAGCCTGTGCAGACTACAGCTAAT
GCTAGCCCAGCGTCCAATTCGGTACCGACTTCTTTGGAGCTTGAGAAGGTGTACGAGCTCATCTGTACACAGTGCGAAACGGGGCCAGCGTCGGAATGGG
ATGAACAGATTCGCCTCGATGTCACGAGAACATTCGGGATATCCGCGCGGCGGCAGCACCGCAAGAGCATAGACCCTACTTCACGTGCTATATGCCATTC
GAACGGCGTCGCAATTCCACTCGAGAGACGGCAAGCAGCGCTGCAGAATGTGCTTCGGGCTTGTGCTAGCGTGGATACCGAAGTCGGGTACTGCCAGGGG
ATGGATCACGTCGCGGCGTTGATGCTGGCTGTGAGTGACTGGAACGAAGCGCGTGCATTCTGGTTGCTTGTTAGCCTCCTTGCATCCCCACGGTTCGAGC
TTGAGAGACTGTATGGGCCAGGACTGCCGCATCTAACTCTCCGCTGCTTCCAGGTAAGAAGGTTAAGAACTACTTTCTCGGGCTAGAATTGTACTAACGT
GTCGTGATGTTTAGCTGGACCGCCTTCTACGAATGCATCTACCTAGCACTTTCAGGCTATCGACTTCCCAATCAGCATCGTTGCAACAGGGTAGGCTTGA
GCACATACGATACAGGTGCCCGACTATTTTTGCGCTAACGCTGATGTTGCTGTATTTGCAGGTGGTTTATGACTCTTTTCACCAACATGGAGGCGCTGTC
CTACGACGTCGTTATACAAGTGTTCGAGGGATTTATTTTCAAGGGATGGAACCATATCCTCCGCACCGCTCTTGTGATCTTGGAGGAGCTGTAGAGACCC
ATTCTTGCCAGCTCTTTTGACGAGATCCCTCGCCTGTTTTACGACATCCAGGAGTATGCGGTGAGTCCTTGCAGGATTTCCATCTCATGCACGTGTATCA
CCATCGTTAATGTCTATTATCTTGCAATATACTTTCGTCTTTGTAGCCTCGACTCATGGACGCGGGATACGTCCTCACGCAATCAGCAAAGTTCGAGGTG
TCTGATCGAATGTTGAAGCGTTTGCACAACGAGTTCGAAGAGGAGACACCGACAGCAGAACCATCCACCAGCAAGATTGCACGACCTCCCAAACTTACCC
CCAAGAACGACAGTCTCACAGGCCGACGCACTACAAACCAGCGCCCTCAGAAAAGAAGAGCATCGCTTCCGCCTTCCTATCTGCGGCCAGAAGCTCGACA
AGAACGACAGTTTGTGTCACGAGATCACATCTCGAAAGCCCCTTCCTCAACAAGGCGAGCCTCTCCGTCGCAAATGCAGTCACCAGCCGTCGTGTGATGA
GGTCACGAACCTCCTGACCTCCCTCCCCCTCAGTATTCTAGTGCCCTAATGAATAGTAAAAACAGATAACCTGTATCGCACAAGACGCGTTGTTTCTCTT
TCTCTTTAGCTAGAGCTTCCGCAGGTTCAAAAATCCCTGTGCCTTCTCATCAAGGTCGTACGAGATGACAACAAGGGCTCGTGCTGGCAGTGCCAGGAAC
AAATCAATCGCCAGGCCCGCCACGTTGCCAGCACTGTGATGCAGACGCCGAATTGCTGGATGGATGGATGATGGAGAGCAAGTCGCCTCTTTCGTATCGG
TCGACGAGCGCAATAGAGCGGCTGGTTCACCGTTCACGAGCACTTGGATAGCTGGGGAGTAGTTGG