Description :
From Genome Similarity Track
Location :
Scaffold_235:72900- 74707
Transcript NameFunction/comments
Hyaar_Emoy2813013GI21899

Sequence
1807 bases(100 bases per row)
CGTCGTAGAATGCCCTGAGCGAAGCTGTCGCGAATTCCCGTGCACCGTCGTGTCGAATGAACTTGACCTTGTATTCAAACTGCGTCTGCACCGCAGCGAT
GTACTTCTTGATGCACTCTTCGCTGTCGGATTTGGCGCGCAGACTAAAACCCTTCATACATCCACTGCCTTCATCGACGATCAGCAGCAAGTACTTGCTT
CCACCCAGCGAGTTGACTTCTATTGGTCCACAAGTGTCGACGTGCAGGAGCTCAAACGGGTCATAGTGGCGCTTGTTTGGGTTGCTTGGAAATGGCCGTT
GCACCATCTTTCCTTCTTGACAACCGCGACACACGCTTGACCCATCAAGCTTCGATGGCATCTTGACGTCCGTGATCATGCCCTTGGAGATCATCTTGCA
CAAGACATCAACTGGTGCGTGGCCCATTCGCGCATGGAGATCTTCAAATTTTGGTTGCGATACAGCTTTCGCAGATCGTTGCGATGTGAGAAACCAGTAG
AGTCCATCCATAATATCCGCTATCGCCACCACTTGCTTGGAGTCTTTGTGCGAAATCTTCATCTCATCCCCATCAAGCACCACTTGGAATTTGCCGCTTT
TGTTGATCTGGGGTATCGACAATAGGTTCTTGTTCATGCTTGGGACGTAAAGCGCGTTCTTGATCTCAACTTCGCGCTCTTCACCGTTGGACAAGACTAT
CTTTTCGACGATAGTCCCAACTCCATTGATTGCCGCCTTGTTCCCGTCTGCGACCAGCACTTCGCCTTCATTGCGCCCGTCCAGAACTTCAAACTTGGAC
TTTTCATAGCAGATATGGTGCGTTGCACCGCTGTCGACTGCCCACATTCCGGACTTTCCCTTGCCCGTCGAAAGTCCGCATTCCAGCGTAACGGCAAACG
CTACTCGATCATAGTCGTAGTTGTTGTCGTTGTAGCGTTGCCATTGGACTTGATTTGCTCCGCGTCCACGAGTATTGTTGCCGCCGCGTCGAGCTCCCCG
GTTGTCTTCCTTCTGCTTGGTCCAGCACTTTTCCACCGTGTGCCCCAATTTCCGCAGAACGTGCATTGACGGAACTCACGCTCGGTGCTGAAGGCCTTGG
TCGCTTCTTCAGTCTTCACCGTTGTCGTTTTGTTTCCTTGTCTCTTGATGTGCTCATTCGTTAGCACTTTCACAACGTCTTGCGATCGCAGTTCCGCGCT
ACTCATCTCCAAGTTGAGAACAACGTTCTCGTAGCTCTTGGAGAGACTGCGCAACAAGCAGATCGCCACATCTTCGTCCTCCATATTCGCGCCGATGCTG
CTGAGCTTTGCGCTGATGTTGAGAACTTCATTGCAATGATGCATCACATTGCCGCCATCTCCATGCTGAACAGCTGTCTCTCAAGACGATCCGTCCCGCC
TTCTGCGATCCGCCGTAGAGGGTCTTCAACCGTGCCCACGCAACCCATGCTTCTTCGCACTCATCAACCACGTGATGGTAATCCGCACCCATGTGTAGCA
ACATCAAGCCGAACGCGATGTTGCTCGCCTTGACGTACTCATCGGACGCTCGCGGGTCGGTGAAGGTCGGAGTCGTTTCACGGTTCACGACATACCAGAC
GGACTTCGTCAGAAACACGCCGCGCATGTACCGACTCCAAGTCGCATAGTTGTCCCCATCGAACTTATCGATGGAGACGTTGGAGGATGCGTTGGTGGTG
GACGACATGGCGCTTGGGCTCATAACCTGTTGTTATATGAGGGCGGAGCGAAGGGAGCGGAGAGACCGAAAGGGGAGACGAAGAGACCGGAGGGAGCAGA
GCGGAAG