Description :
From Genome Similarity Track
Location :
Scaffold_3375:729- 3244
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3375-fgenesh-gene-0.0Cell division protein ftsZ
Pytiw_DAOMBR242034maker-piw_contig_3375-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2515 bases(100 bases per row)
GATTAGATTGGCGGACGATGTGCTCTTGGATGGCGTGAAGAACATCTCGGACCTGATGGTCACGCCGGGCCTCATCAACCTCGACTTTGCCGACGTCCAG
TCGGTACACAACAGCTCCGCATGGCTTGATATAAATCAGATGGATGAAACTAATGAGCTCTCTGTGGTGCTGTAGGTGATGTCGAACATGGGCAACGCGA
TGATGGGTAGCGGCGAGGCCGAGGGCGAGAACCGCGCGCTGCGTGCCGCCGAGATGGCGCTCGCGAACCCGCTGCTGGGCGATATCTCGATCAAGGACGC
CAAGGGCTTGCTCGTCAACATCACGGGCGGCTCGGACCTCACGCTCTTCGAGGTGGACGAGGCCGGCGACCGCGTCACCAAGGTGCGTCTCTTGCTCATT
GGAGCTCTTGGGAAGGAAAAGTTGGAATTTGGTGGTGGCAAGATGCTAACATTGTCGAATTGTCAAACAGGAGCTGGACGACCCGCACGCCAACATCATC
TTCGGGTCGTCGTTCGACGAGTCGCTCAACGGCAAGATCCGCGTCTCGATCGTCGCCACGGGCATCGCCGACCCGGAGAAGAAATAGAGGACGACGACTT
TCTGTAAGAAGCTTATCTTGTCAATCATGGTGGCTGGTGCTGGTTCTGGTCCTGTAGGGAAACGAATTGTTCGCAAACGCCAACAACACGTCTATCAAAA
ATGACAGTCTTATAACAAAATTTACTGTCGTGCAGCCAACCAGCCAGCTTTGCCACGCTTCTGCTTCGCAATGCCAGTCGGTCCGCTTGGTGATTCTGTC
TATCTATTGGCCCTCCCCTCATCTCATCCAAAAATGTGGACTCTTCATAGCCCCACAAAGTTACAGCGCCACCTCTTCAGTGGACTCCCGCGTGGCCGAG
AGCCGCTGCGATAACCGGTCGGGAGCGATGGACGCGAGCACGGCCTCCGTGTCCTCGTAGGCGTCCCACATGGAGCTCAGGCGGATGAGCACTTCCTCAT
ACGTGGCGCGCACGCCCTTGGGCAGCACGACGTTCTTCATGGCTTCCTCGATCGACACCTTGGAGTCTGTACACCGCTGGTCGCCGTACTTCTTGGCGTA
CATGTCGTCGCTGCCCGCGTCGCTCGGGGCGTACTCGGAGTGCGTCGGGCTCGACGGGAGCTCCATGATCGGGTCGTCCGAGTCGTTGCGCTGTGTCGAC
GTGTACGAGTCGTCCGAGCCGTTGCTCATCGTGTTGCTCAGGTCGTCCGTCTTCTTGCTGTCCTTCTCCTGCTTCTCCTCCTTGGACGGGTCTTCCACTG
GCTCGGGACCCGGGATCGTGCGCGGCACGTACGCAAAAGACCGGAGCGAAAGCGCCGTCTGGATCTTGGGCAGGATCGATGGCCCGATGGGCTGCGCGCC
GCGGATCAGGAACGGCCGCACGAGCTCCTTGGCGTCGTCGCCGCAGATCGCGCACTTGGGCAGGTCGTTGAAGATCCGCTCGACGAGCAGCTGCAGAAAG
TCCTGGAGCGCCGTGACGCGTCGGCGCACGACGGCGTTCGTGCGCATGAGCGCCTTGGGCGGGAACGCGAACTTGCTGAGCGCGATGTGGAACGAGTGGC
ACCCGGGGCAGCGCGCCTTGTCCGCGAGCGTCGCGAGCAGATCCTTCCTGAGCTGCAGGAACTGCGAGTAGCGCCGGTTCACGGTCCACTCCTGCGCCGC
TGGCTGCACGGCCATGCAGATGCTGTAGAGCGTGTGCGTCGGTCGGTTGAGCGCCGCCGGGATGAACACCTGCACGCCGCTCTGGAACGGCCGCTCCGTG
GGGGACATGGGCGGCATGTGCTGCATCATCTTACTATGGCTCTGTTGGGGATGGCGAGCGACTGTCTGCTGCTGCTATTGCGTGTGTGTACCAGGCCGCG
TGTCGTGCTGCCGGTGGGTCGATCCGAAAGTTCCGAACTGACGCGTAGCTCATGGCGAGCGACAGCTTCCGAGCGCGCGCGAGACATTCGTGCGACGGAA
CGGCGCGAATCGAGCGGGTCCATAGAGAAACTGGATGACTAAATAAACAGACACACAAGTCATGCGTGATTGGCAGGAGTAGTGGATTTATGTACCTTTT
TATTGTAATTAAAACCTCTATGTAAATACCACATTTGATAAATGTATGTTGAGTGGTCAGTGATAATACTCTATATGGGCTGTAATATGGGAGGGGGAGG
TGAGTGTGCGTGATTGTGGAAAAGAAAAGAACAGTTTTAGCTAAAAATGAGGCTGGTCTCTATCCCCAGACGCATTACCTTACGCCAGGCATCGAACCAG
GCGACAGACAGACAGCAAGTCGTGGCTGTCGTCCGCCCATGACTGCGGCTGGCCATGGAGAATGCCAGTAAGCTCATGCCTCGTGCGTGTTGCCAACCAG
ACCAGCCAGCACCACACCCGATCTGCTCTTTTCGCAAGCATCACACGAACGCGAAGCCAGCCCAGTTGTGATAAAGCCTGATTGCCAGGCATCGGCAAAT
TCGAGAAATACCGAA