Description :
From Genome Similarity Track
Location :
Scaffold_3096:729- 3242
Sequence
2513 bases(100 bases per row)
TCGATGGCGTGGCTGGTCTAGTCACGGACAAGAAGGTCTTCCTAGAGTCGCTCCTGGAGCTCTCCCATCTGCTGGCACTTGAAGAACTGGGATTCTCAGA
AGTTCTTTGCGAGCTCAAAGCTGGAGAAATTGCTGAGATGGTCGTGATCCGGCCAGAGCGCGACACAGTCGAGCTGAACTCTTCCTCCGTGATGGACGAG
GCAATCCTCGAAGGTTTCAGGCAAAGATACGAATCTCGGCGTGGTACGCAGATACTGAAGGATCCATCTGATCCTCTGTATCAGGTCCTCAAGGTGTTCG
GTGATGAGGTGCGAAAAGATTCTCCCACGGATCTTTCCACCTGACCGAGGGGTACGTCATGAAATTGACCTTGTACTCGGTACCAAGTACTGTGTCACCA
GACAATGGGCTTTGCCAAAAGGACAGGTCGATTTCATCGATGAGTTCTTTGCAGCCAAGCACGCTACTGCGTTTGTTCGCGGATCAAAATTTCCTCACAT
AACCCCACTTACTGCGCTCGCAAAACGAATGGGAATTGGCGGATCGTGCACGATCCCGGCTCAAACGATCTTCCTAGGAAGGACGTCATGAAAAACATGA
CAGGGTGTACTTTGTGCAGTGCGCTCGATTTGGTAGATGGCTACTACCAAATCTTGATGAGGAAACGGATATTCCGCTCATCGCGGTCAACACACCAAGC
GAGATGCTTTGGGAGTGTTTGGTGATGCCGCAAGGGTTGTAGAATGCACCCGCAACGTATAATCGTGTGGTGACACATCTATTTCGTCCGATGCGCGCGT
TCGTGCAGACGTACTTCGACGACATCTTCGTGCATAGCAAGGCACAAAATGGGAAGGGTGATGTGGAGGTCCACATCGAGCACTTACGCCAAGTGCTAGG
TTGCACGAGAGAGAACAAGCTCTATGCGAACCTCGATAAGTGCATCTTTGCAGCGGAAGAGGTTCCGTCCCTTGGATGCTTTATCGACAAGGACGGCATG
CGTGTTGATCCTGAGAAGGTGAAGGCAATCGTGGATTGGCCAACACCTAAAAGTCAGAAGGACTTGCAGAAGTGGTTGGGCTTTGCCAACTACTTGCACC
ACTATAGTGACAACTATGCGAACATGGTGTGCTCGCCACCCGCTCTTCTGCAGAATGATTCAGAATGGCAGTGGACTACCGACCATGATATCTCTTTCAC
TGTGGTGAAAGACAGTCTGTTGGAAGCGCCGGTCCTGGTGCTTCCAGACTCGGAGAAGCCGTTCACAGTCGTCTGTGACGCTTTTTATTTTGCAGCAGGC
TGCGTGCTGTTGCAAAAGGATGATGAAGGACATGACCGTGTCATCTCATTCCAGTCTCGGCAACTCAAGGCTGCTAAGAAGAACTATTCAGTTCACGATA
AGGAGCTACTTGCGATGAAGTACGCTCTTGTCAAGTTCAGAGTTCATCTACTCGGTGCCAAACCCTTCGTGGTGTTCATGGACCATGCATCCTTGCGAAC
TGCGACGAACTCGCCACATCTTTCGCAGCGCATGGCGCGCTGGTTGCTATTCTTTGCAGATTACAACTTCACGGTCGGGTACAAGGCAGGAATACTGAAC
GTTTTGGCTGATGCGCTCTCGCGACGACCAGACTGTGAGCTTGCTCATATTGTTTTCCATGGAAACGTCGCTCTTGAATCGTATCCGAGACGGTTATACC
GTTGATGAAGATCAGCCTCGTGTGGTGGTTCCCCACTGCAAGGACATCGCACATCAGATTTTGTTTGAAGCGCACGATGCGCTGGTGAACGGGCACCTTG
GTTGAGAATTTTTTTTACTCCCGCGAGAGTGAGTGCTTTTAGTGGCGCCACATGAACAAGTGGGTCGCTGCGTACGTGAGGCCACGTGAACTCTGTCAAC
GCGTGAAACCGTCGCCGCACGCGACAGTTCCTCTCCAGAGCCTGCCGGTGCTAGCTGACTGCTGGAAGTCTGTCTCGGTGGACTTCGTCTTTGGGTACCC
CAAAGACAAACAAGGACACACTGGAGTTGTGGTCCTGTATGCCACCTAAGTAAAATAGTGCTACTGGCGCCGGTGCGTGAGAGCGTCTTAGCACTTGAAA
CGGCGCGTATCTTTTTAGATACAATGTTTCGGCATCACGGATTGCCTGAGACCATCGTTTCCGATCAAGACTCGCGCTTCACTTCGCAAGTGTGGCGCAC
CCTTTTCGATGTATTGGGCACGCGGTTGGGCATGTCAACCACCGATCACTCACAATCCGACGGGCTGATGGAACGCGCAAACCACGTCGTCGAGGACATC
CTCTGCTGCTCCCGTCAGTAGAATTTTTTTATCAACAGCACAGTCCACGCATCAAAGGGCTTTACGCCGTTTTACGTGAATGCGTTGCGCAACCCGTGCA
TTCCTCTGACTCTTTTGGGACATAGTCCTAGACAAGAGGGAGGAGGAGAGGGTCGTCAAAACTTTGACTCCCGATTGGCTGAAATTACGCCAATCACAGT
GATAAAGCAGGTG