Description :
From Genome Similarity Track
Location :
Scaffold_334:729- 2344
Sequence
1615 bases(100 bases per row)
CCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTTTAATATGATGAAGTCATCATCGTATTGG
ACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATCCTCGTTGGAGGGATCTCTC
GCTCAACATATTTGAGCTCTCTTTTTTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGTCCCACAATCGACTAGAGCTCGAAGCGACATGCCTTGTGT
CACTTCGAGTTTCAAGGTAATGAGGAAACCTCATTACCAGAAGTAGCAACACATAATGACTGAGTGTTGGGAGCAACTTTCGTTAAGAGGCCTGCAAACT
CACTTGACGTTGCTGTATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCTTCGCAACAACGTCGGACCCACGCCTTGGATCCCG
CTTGGCCGCTTGGCGGTTATTGTTTCCTGTGGTACGTGGTACCGCTCTCGGGGCAATGCATTCTTATGCATAATGCCCTGTACTCTGACATCTATTGTAT
TTTTGCAATTTCTTGTAGTTGTTAACACGAGAGTTCTCGCTCCCAGCGTGACAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTTGACGGAC
CATAGGAATTCGAATTCGCGTGAGCCTGTTTCACACTGAAGTTCTCCTGTTTCGCAACCCTTATTTGCCTCTTCTAGGGTGTTGAACTCCAACCGGAACA
GTTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACG
TATGTACTGAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGCTCAGATAGAGCCCTGAACTCCGCTCGTGGCAGCTCAAAAGTTTGC
CTTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCAATT
GAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACGAACCGTCTCAACAGAGAGTCTTCATCGGCTTC
CTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGGTCGACGTGTATACGTCGGCCCGGTAGCAGTGGCCTGCTGCTGTCTCAACAGTTCAAACTGTTGA
GCACTATGTTCTCTCAACAGCTCTGTCTGGGTTGAGAACCTTGTTGGTGAAGCAAGGTTACTTTTTCCCGCTTGGCTTCAAGTTCGTTCTGAATGAACTT
GGCGATGGTGGCGTGCTGTCCTTCTGGCCCCAGGGCAGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTTGAACTCAAGCGTTCAACAGCGTCTCAT
TCGATTTGACTTAAATGCGAGTAGCTTTCATCCGTGGGATGAAAATCATCCCCCTCATCGTCCAACATGTTCATGGTCGTTGAACGGACTACGAAGTGCT
ACCAGGTGTAACGGG