Description :
From Genome Similarity Track
Location :
Scaffold_25:72884- 75537
Transcript NameFunction/comments
Phypl_g1057hypothetical protein

Sequence
2653 bases(100 bases per row)
GCTCTGCACTGTGAATTTGTTCACTTCGAGGGTTTTGATCACCGTCGTCCTGATAAACTGGTCGTTCACGGTATTGCCGAGATTGTTTTCGTGGAGAGAG
TTGACTTGATCGCTTCGTGTCATCCTGTGCAGGAGGCACAGGGCTCGTGCTAGGCCACTGCTCTCCAATACTGTCATCATCGGTAAGCTGCACTCGATGT
GTTTTTCTCGTGCTGGAGTTTACACCAACTCGAGTAGAACTTGCATCTCTAGACACAACTTTCCACTGCATGAGAGTtccgtcgtcgccaccgACAGTGA
TTAAATACGCGTCGTCAACTGAGAAGCTCAACGTCGTGATAGCTGATGAGTGAGCCTTATAAACCTTCCTCTTGGCGCCACGAGGAGCAGGGTTCTTGAG
AAGATGGATACTTGATCGACAAGCAACAGCCAGCATGTCTTCGCTGGAGGTCGAATGCGGACTTCTGGACTCGCCAACTTCATTTAACCTTTTTGGACCC
GTAGCGCTGACAGCAGCGATGTCCACAAGATTGGGTGACTCCTCTGACCAAATGCCGGGCGTAGGCCACCCAAATACGCACGTCCATTTAATCCATTGCA
CGTCACGGACTAGGAAAGCGTCAGTGATCTGCTTAGTTTCGCCCTTTGTCGGCGATACTAGCCAATGGAGAATCTCACCGTCCGCTGCATTGCTTTGCAG
AATATCACCATCCTTATTCCACGTCAAATGGATCACAGCGCTGGAATGGCCGTCGCAAACGTGGAGCTTCTTGTAGCCGTTGATGACGTCGTAGACATAA
ACGAAAGTGTCCTTCACCCCAACTGCTAAATATTTTGCATTTGGGCAGTACTTTACTTGGGCGATGGCTCGAAAGCCAGGGCCAGATAGACCAATATGTA
AATTTGTAGTGCTACAAGAGTTTGACTTGATGTTCTTCCGTAGCAATACCTTGAGCGAGTCACAATCCACAACCAGCAGTTCACCTGAGCTAAGTCCAAT
GGCAAGTTCGTGCCCAGCGGGATGGAACTCCATGCAAAAAGCCTTGACGCCAGAGGTGATAAAGCTTCCAAGATAAAGACGACGTGTACAGGCGCGCCGT
TCGAGATCCCAGAAACTAAGGTATCCATCTTGAGACACCGTAACTACCTCCTCCATTGCAGGGTGTGCTGCACAGACTGCAACCGCACCACTGCGAGCTT
CGAACAACAATTGCCATTCACCGGAAACGGTGTTAAGTTCCCAGACGCAGCTATTGCTAGTGGCAACAAGCACAAAGTTGCCGTCATCTTTCCACACAAT
GCTCGTGGGCTTCGGCGTAGCAGCCGCGCCACCCGCGCTAATTTCATTTGGTAACACAGTGGGCAATTGGAACAACTTCGTTGGATCATCAATAGGAAGC
AATGCGTGCGAGCCTTCTGCAAACGTCCCTGTCAATGGAGTAAAAACGCCTTGTGTATTGACTCCAGGAATTCGCATGGGTTTGCTCATTTGACACGTCC
ACAGCAATAGTTTCCCATCGTTGCCGCATGACATGATCATATTAAGCTTCTTGGAGTACGCCACTTGGTAAGTTGCTCCTTGATGAGCTAGCGGCCCACT
ATATTTTAATTCGTCCCAACGGAAATGCAAGGCAGTCGAGTTCGGCCGCAATGCCATTTTCTTGGACAGTCCTTCCATctctgcttgagcttgtctAGGT
ACCTTAAACCGATTCCCTGTTTCTTGGTCGTGAGGTACAACATCAACAAGTCTTCCAGTCGGCTCGTATGCGATCTTCTCCAACACAAGTTCATTGATCT
CAGCATCGGTGAACTCGTCTGGGACTTCCCACCACTTCGCAGGCTCCTTTCCTAGGTCACTCTCGCAAATGATATGAACATCAGGGCTCGCTCTTGGCTG
CAAGAACAGACACAAATCTCCTTTAGCCGTGCCAGCTATGATCCGGCCGAGAGAATGATCAGTGACATTCGTCGCAGCCAATTCCTTCGAGTGTTCATCA
TACACGTAAACAGGTGGGGAATCGTTCACGAACGTCAAACTTGTGAAGTCTTGGACCTCAAAGCGCCCATGAAATGACGGGACGTTGCCCTCTAGCTTCC
ACACTTTCTCGGTCGGGGTTGGAGGACGCAACCTCGGAGGACCACCGAATGTGGAGCGAGAAAAAGCACTATCAGCGTTTTCCTTTGAAAGGGGTGGCAC
ATAGTCGGCTTTTGTGAGAGTCCAAAAGCGGATATGCCGGACACCGCAGCTGACCAAAGTATAGCAagcatcgtcgtcgtttAAAGCCTGTCCTGGCTTC
TTCGATCGATGCGCTTCGGGTCGACCATATGCCTGAAATGGGTTGAATGCAACCGCGTGGACTCGAAAGGTGTGACCTCGAGCACTAATCAACAGTTCCT
GAGCTTTCCAGTCGTGAATGCAAATAGTGTTATACATATCCCCACCCAAAGAAGCAATTAGCTTGCCGTCGTGGGAAAAGCTAATAGACCGCACTGCGAC
TTGGTGGCCCTTTAGACAAGCGAACCGTTTGCCAAGCGGTTCGTCGCTTGCATTCCACACCAAAAGAAATGCGGAGCGTCCCGCTTGTCCTGATGCTACA
ATTCGTTGGTTCGGATGAACCGCCACGCTTGTGACTTCGTTAGTGTGCTCTCG