Description :
From Genome Similarity Track
Location :
Scaffold_16:72877- 74011
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08708hypothetical protein

Sequence
1134 bases(100 bases per row)
AGCCCATGCAGATCACCCCGCACACTCAGGACGGCGGACGCTGCGTTGAGCTGACGTGCATGGCGGACGGGTGTAACGATGCCTACCAGTTCCCCAAGGA
CGACACCAAGACGCACACGTGTCCTCTGTCCACGGACTTCGACCTGACGTTCTGCCCTGGTGGCTCAGGCGGCTCCACGCAGGCTCCTACGCAGGCTCCA
ACTCAGGCGCCTACGCCGTCTCCTACGCCGACTCCGACGCCGTCACCCACGCCCACTCCTACTCCGACCCCGACGCCTACGCCGGAAGAGGAACAGCAGC
AGGAGCAACAGGAGCAGCAGGAGCAGCAGTCGGCTTCTGCTGGTTCGGCCGGTCAGAAGCAGGACCAGAACGTGGACCAGAAGTCCAAGTCCGGCTCTGG
ATCGGACACTGAGGCTGGTGTCACCAAACTGCGCAAGGTCAACGCCGAGAGCGTGCAGAGCTCCACGGCGCAGCAGACTACGCAAACAACTGAGACAACG
GACAGTGCCACTCAACAGATTGGACAGACTCCTGCTGCCGCGTCGAAGGAAGACGAGGTGCAGAAGATCAACAATCAGGCCTCGGAAGGCAGCAGTAACA
GTATTCCGTGGGTTGTGCTTTGTATCGGTGGGTTTGTCGGAATGGTGGCCGCTGCTGCCATCGTTGTTGTGCGCAAGAAGAAGAGAGCGCTCGAGGAGCT
GGAGACCAAGACTCCGGTCTCTACGACGGCTCATGGCGCGCTCGCTACGTTCCGCACGCCCCGCGACAACGTCAGCGTGCTCTAAGCATGCAGAGCTGCA
GTTTTGGATGTGGGCATACACACTTTTTTATCTGTAGATACGGTAGCTAGCTAGTCGCGCGAAGTGGAAGCGCTCCAAGTGGCTAGCGACGAGAGAAGAC
GGATTTTTGATCATACAAACCTTGTGTGTGTGTGTGCGTCTTTTGTTGTTCGACTTATAGTGATATCGTTATAATAATTGCTATGTAATCGTAGTAATAG
TCAAGTTAACCAGGTACAGCAAAATCGGAGCTTCGATACTACTGTATTAGTACTACGTAGAAGTATCCAACTACTAGGAGTTTGAGTAGGACGATCAAAT
TATGACGTGAAGGACCATTTTACTGGACAAGGTG