Description :
From Genome Similarity Track
Location :
Scaffold_68:7286- 12175
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_68-abinit-gene-0.55Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.20Gene of unknown function

Sequence
4889 bases(100 bases per row)
GGGTTTTGTGGATGTGAAAGGTGTCGGATCCCGAGTTCGTTTACCCGCATCCTACGAATAAAATTGGTGTTGTTTACCCAGCACATCGCTATCTATATCA
GCAGATATTTTGGTCATAAATGCCCTCACCCTCAATGAATGCGACCACTATTCAAACGCACGGATGGGATTCATCCAAAAATGTAGCAAAGGCCACATAT
CCGAATTTTGCGAGGCGGCTTCGACACATCCGACTGCGTAGAACTCAAGACAACAGATGCATGCATGCAGGAGGGAGAAATAAATGACTCGTATATTGCT
GTCTGTAGCAGAGTGCCGAAGTGGCTCGCGTCCAACAACATCGCTGTACGAACTTGTTCCAGCCGACTCACTCCCGACAGTGGACCTCTCGTTGTCGCTC
AAGTCTCGTTTCCTCAGTATCCCAGCTCTCAACCGACTCAATTGGATTCTGGCAAAGAGATTCCGAGGACCGATTTCGCTCGCTGGTGTGACCCAAATAA
TCATTTACCTGATTGTGTTGCTTGCACGCAAAGATGTTGGGAAAGTTCTCTCCATTATAAGCACAATGATGTACGTGATGACGCCAATCGCCGGATTCAG
CTTTCTCCGAGTCAATGTCGGGTGGCTACTGGTCGCGACTTACGATTTTTGGTTCTTCACGTTCATCAGCACATCCATGTACACCGTGCTAGCGCTTCTC
GTGGACGATATCCGCGCTGTGGCCATCCTCGTGGCGTGGTTCGGGATCCAGCTCAATATTTTGGTCGGTGCGAATCTCCGCGCAGTCAAGGCTTGAGTAA
TTCTAACAATCGGTGGTATCATCTCGCACTTTATCATCTGGGGAGCTGTTGGTTTCGAAGCGATCGAAGACACGCACGATTTTGCCGTGCTTCGATACAA
GACCCACGAGCTCCCCGCTCGAGAGCTGGTTTGCAGTGGAATCGTTACGATCATCGCGTTGCTCGCACCCAATGCCCACCGCAAGCGCAAGATTTTTCAG
AAGAGAGAGAGTGGAACGTGGATTGAGTGTGTGAGCTACCCCACTGACCTCAAGTTCGCCGCCAACCAGAGCAAACAAGCAAATCGCATCTCAGCTTATT
TAACAAGCCTATGTCAACCGCGTCCCCCGAAAATATTCAGAGGATGCGATACATCAAATAGGCTAGGCTAATCAATGCTCACTCTACTCTCCTGAAGGCC
AAAATACGGTCCTGGCACTGTTCCGCGTTTCCGAAGCTCGGGCGCACAGCTTTACTCGCGTTCGTGGCATCGCACATCTATCAAAGAAAGCTCCACGGAC
AAAAACATCAAGTTCCAGCCATTCAATTGATCGCGCTGATGCTTACGTTGGCGTTTTGCGGTATGTATTTCGCACAGTGCCAGCGCGACCTGCTCTGGGC
ACTCTGTACGTCGTTCAACTTCATGTTCCTGTCCTTCCAGCTCACAGTGTCCACCTTCAGCGTTTGCGGCTTTTTCGAGTGGATCGAGGCCTCGTTGTGG
TATCGTTGACCTCGTGGATTTGGACCCACTGGATCTTGTTCCTGGACGCGATCACACCAATGGGACGACTGAATATGGGCTTGAAAAAGCGGCTCGTATT
GATTGTGCTCTCGACGTTGGTGGGGGCGTATAGCTTCTTGATTTACGTGCTAGTGTTCGCAGAGGATTCCGACAAAATCCCAGATCACGTGGTTTGGCAG
CAGGGCGAGATGTTTGGCGAGACCACGCAGTTTCGCTTGATGCCACTCTTCTACAATTGCTTTGCAACTGCACTGCTGTTCGTTCTTCGCTTGCTGTGGC
GAGTTGCTCGCAATGATTTCGATGTACTGTTGGTTTTCGACAGTGCGCTTACGTACGGGAACTACTTGGGCAAGGCAAAGGGTCAAGTGTCGAGACGCTA
CAGGTCGTACCTGCAACAACGAAATGTACAGAAAGTGGCTCCTCCGCATCAAGACTTGGTGTTGGTGTCCAAGAGTGCGTGGAGAATGATGCCTCAGTCG
TTCATCGTGCGGAATACTCAAACGTTAACCCCACCTATGTAAGATTTCACTTTTGAAGTGCGGGCAATGTTCATGACTGTTTTGATCGCTCGAGTTTCCA
GTTTATCAACGGCAACGAGAAATACCTTTTAGACCACGATTGCTGGATCTGTGACGAAAATTGCTGGGCCGGATTCGAGCAAGATAGCCGGCCGATCCGA
TTGTAGTACATGCGGTCATAATGCGTAGCTTTTGCGATCTGCCTCGACCATCAGCTCTCGGCTCTTTCTAAGCTTTAACAACACGTGTTGCTCAGAAAGA
TTCAGGAGCCGCATAGACCCTTCCCCTGGTGCTGCGGCTCATCAGATTTCTTTTACCACGCTGTGTGTCGAAATTGAGAAAGATGATCCAGTCAGCGAGA
ACAGTATGTCGTCAACTTACCCTGAGTTCAGGCGTTCAGATGCATTACGAAGATAATCAGCAAACAACGAGCTACTATGCGATATTACTTACATGACTGG
CAACAAAGGAGATACCATGTTCAGAGGCTTGCAGTCAGATGTGGTCTCTCGTCTGTACGAGGACCGTACAGGCGGATCACATGCACCAGTTTCTCATACA
TTGCCTGGTTCTTCGGTAAGGACAGCGGCCTATGGTTCTCGCCATGCTCAAGGATGATTTCCCAGTCGGCACACCCACTGGATAGTCGTCGTGCTGGTTG
GCGAGGCAATATGATTATGGCGCTACCGGATCCTTCTTGCCGATGATATGAACTGACGAGAATAGCACAAGGATGCGTTTCCCGCCAGGGGTCTTGAAAA
GCGAACGGCAATTACTAGCAGTGACACTCACGCCACTAAAGCACGCCACCAGCGTTCAATAGCGCTTCTGATGGCGCTGCAAGTACTACATCGACAGCAG
CGTCAGAAACAGCGAGCCCTGGGAAAAGCCAATCGCGACGTCAAACAGGTCGGCACAACCCGGGGGAGTCCCCAAGAGTCCGTCAAGAAGCACGAACTCA
GCGTCGGAGCCGAGCATCTTCTGTAGCGGCGCCGTCTGGTCGCACATGACCTGACTATTCGTATGCGAGCCATAAAGGCAAAGCACGTGCAGTTTCTTCG
CCATCGCTGATGCTGCAGCAGCTAAGAATCGAGCTTGCGAGGGTCAAGCGGCGCGTCGACTGCGCTTCCAGTGATCCTTGCAAATGAGAAACTCAATGCT
AGCGCCGGTGAACACTATGTTCCTCTCTCCTTCTTGCGTTCGCGTGATTCGTACCAAGCGTTCCCGAAAAGAAATGGGGAAAAGGACAAATGATACGAGA
GATACTACTTCAAGGTGAAGCTGCCAATCAAGCGCCGCCGTTTCAGCCAATCAGTCTTAGCCATTTCACGGGGATATGAGTCATACGCAACTTGAACTTG
CTTGACTAGATCTCAGAAGCAACATTGCTCACAGTCCACCTCAAGCATACACAGCACCTTTATTGCTCATACAGTAGCAATAGAAGCGATTGCTGCGTCT
GTGCTTCAGCTACAGTCTGGTGATGTCTTGGCCCAAGCCACTCGCTCTGGGATCACAGCCGTGACGCTGAATTTCCCAGATCACCGCTGCATAAAGCACC
TGGCTCTTCATGGAGGACAGGAATCGGTGCCCTTCGTCGTGCTCAAGGACGACTTTGTGCGTCGATCTACCATTTGGACACGGGTCGTACATTGCTGCCA
GCCTCCGGGGTTCTTCTCGAATGGGATCTCGTTTGCCGATGATGTGCACCGATGGGAGTGGCACGAGCAATTCCTCCCCCTAATCGTTTCAAACATCCAG
CGACAGTTGATGCCGTTCACGCGAAATGCCGCCAACGCATACGTCGAGTCTCCATTGGTTCTCGTTTTGCGTTCGCAGGTACCACATCGCGAGCACTGTG
AGGAACATGACGCCTTGAGAAACGAAATCGCGACGTCAAAAGGGCCATGCTGGTGGATCTGGTCGTCCGCGTGCGCAATGGCTTCAGCGAGGCTTGGCTN
NNNNNNNNNGGCTGCTCACACCGACGTGGAATCGGACCCATTCGTAAAATGGACGCACTCGATCGTAATGCTCCTCAATCATCGCGTCGGCCTTGCCTTG
CGCCTCCAGTGGCGCGTTCATGAACACGAACTGTGTGCGGGCCTAGTGCCTTCCACAGCGCTTGAGTCTGGTCACACATGATGTAGGCGTTTGTATGCGT
ACCATGCAGGCAAAGTACGCGCAGCAGCTTCGTGTCCGGGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCAATGGCGTTATCGC
CATGCTGCGTTTGTTGCAGCAATATTGTTTTACAATTCGCTTGTGGAGACCGGGGGTAAATTGATTTGTGGGGCGTGAGTGGAAGTTCTCGGGTTGCTGG
AATCACTCCAAAGTCGCGCCGCCATCGTGATAAGCCTCGTAATTCCCCCAACAGTCCTGGACAAGTCACTCGAAACCTAACCGATGCTGTGGTGCACGCC
GATGTCGCCAGATAGATGCCACATCTTCAAAAAGTATATGTTATAGAGCAACTACCAACGATTGCACCAGCTTCAAGCGAATGCAGAAACTTAGGATGCG
TATATTCACGCGCACCTCGATTCGGCTCCATCTCCAAAGAAGAAGAAAAAAAGAGAACGGAGGACTTTGTCGGCCGAATCCAGGTATTCTACTACCAAAA
ATTAAAAGAAAATGAGATCCGAAGGTTTTGCGCAGTCCGAAAGAGCGCATCAAGAGCACAGCAAGATGGCTGGCCGAAATGAAAAGCAGCGAATGTTGGC
GTTCCATGGGGGCGTTGAAGGTTCTAAACGCATCAAAGTAGCAGCAATACGATTTCGGGGAAATTCAGCATTCATTTATTTGATCCGGG