Description :
From Genome Similarity Track
Location :
Scaffold_317:7285- 12384
Transcript NameFunction/comments
Phyra_47235eukaryotic translation initiation factor 5B
Phyra_85808hsf transcription factor

Sequence
5099 bases(100 bases per row)
GTCTGAGCCATTGATTGCCGAGCCAGCCGTGCAGAACCAGAACCGGAATCCCTCCAACACATCCAACAAGTCAAGAATGGCGCCGAAGAAGGGGAAGAAG
AACGCCAAGAAGGCCGCGGGCACGGCCGCCGCCTCGGACGACCTCGACGACCTGTTGAACGAGTTTGCGCCCAACGAGGACGTCAAGCAGCAGCAGGAGC
AGCAGCAGGAGGGGGACGACACGAAGCAGGAGAAGGAGTCGGACGTGGATGCCGCCGCTGCCGCGTACCTGGCGTCGCTGGGCGTGGCCCCCACCAGCGC
CGGCGGTGAGAAGAAAGACGACAAGAAGAAGAAGAAAAAGGGTAAGAAGAAACCTAATGCGGACGCCAAGAAGGACGACGACAAGAAGCCCATGTCGGCC
GCGGCCAAGGCGCTGATGGAGCGGCAGGCAGCGCTCAAGGCCGAGCAGGAGCGTCTGGACCAGGAGCGTCTGGAGCAGGAACGCATCGCTCAGGAGGAGG
AGGTCAAGCGCCTCGCGGAGATCGAGCGCGAGGAGGAGGCTCGTCGCAAGAAGAAGGAGGCCCGTGCCGCCAAGATCGAGCGCCAGAAGAAGGAAGGCAC
TTACATGACCAAGGCCCAGAAGCAGAAGGCCGCCAAGGCGCAGGCGGCTCTGGAAGCCATGCAGCAGGCGGGACTCGTGCCGGACGCCGCTGGCGAGAAG
AAGAAGGTCGTGTATTCGGACAACAAGAAGAAGAGCAAGAAGAACACGGAGCAGAAGAAGGAGGAGAATAAGAAGGTGGAGGCTAAGAAGGTGGAGGTAA
AAAAGGAAGAGGAGGAGGAAGTGGACGACTGGGAGAAGACGGAGGACGCCGCTCAGGAGGAGGAGGCTGAAGCCCCCGACGCCTGGGATGACGAGGACTG
GGAGACCAGCGACGTTGTGGCCTCGCTGGAGGACAAGCTGCACGAGGTCAAAGAAGAGGCCGCTGCTGCCGACAGCGACAGCGAAGGAGACGAAGATCTG
CTGGTGCTGGAGCAGAAGAAGGAGCAGGAGCGGCTGCGTCAGCAGGGTATTGCGCTGATGAAGCGTCAGGAGGAGCAAGCTGAGCAAATGCGTCTTGAAG
CTGAGGAGGAGCGTCAGCTCTCCAAGGCCAAGATGGAGGCTGATCGCAAGAAGAAGGAGGCGGCCGAGCGTCGTCGTAAGCGTGAGGAGGCTGCGCGTGC
CAACGTGTCGCTGGACAACCTCCGTTCCCCTATTTGTTGCATCATGGGCCACGTCGATACTGGTAAGACCAAGTTGCTTGACAACATCCGACGGACCAAG
GTGCAGGACGCCGAAGCCGGTGGTATTACGCAGCAGATTGGTGCGACGTTTTTCCCCGTGGAGGCTATCAAGCAGAAGACGGCGCGCCTCGCCGAGACCA
TGAAGCTGGAGTACCGCCTGCCCGGTCTGCTTGTGATTGATACGCCTGGTCACGAGTCGTTCACGAATTTGCGTACTCGTGGTTCGTCGCTGTGTGATAT
TGCTATCCTGGTGGTTGACATCATGCACGGTCTGGAGCCACAGACTCTGGAGTCGTTGCGCCTGCTGCGCCAGAAGAAGGCCCCGTTCGTGGTGGCACTG
AACAAGATCGATCGTTGCTACGGATGGAAGGCAATGCCCGACATGCCAATTCAGGAGGCGCTGAAGCACCAGAATGAGCACGTCATTCGCGAATTTGAGG
ACCGCATGAAGTCGATCATCGTTGAGTTTGCGGAGCAGAAGCTGAACGCCGAGGTGTACTGGCGTAACAAGGACCTCGCGCGCACGGTGTCGCTCATTCC
TACTAGCGCTATCTCGGGTGAGGGTGTTCCGGATATGCTGATGATGTTGACGCGTCTGACGCAGGAGCGCATGGCGAAGTCGTTGGCATTTGTGGATATT
CTGCAGTGCACTGTGCTGGAAGTGAAGGTAATTGAGGGTCTTGGCACGACGATTGATACGATTTTGGTGAATGGTTCGCTGGAGGAGGGCGCGACGATTG
TCGTGTGTACTTTGGACGGACCCGTTGTGACGACCATCCGTTCGTTGCTGACCCCGCACCCTATGAAGGAGATCCGTGTGAAGGGCGAGTACATCCACCA
CCAGAAGATGAAGGCCGCCATGGGTGTGAAGATTTGCGCGCAGGGCCTGGAGAAGGCGGTGGCTGGCACGCAGATTTACGTGGTTGGTCCCGATGACGAT
GTCGAGGAGCTGAAGGACTCTGTCATGTCCGACTTGACAGGCATTTTGGATTCCGTGAAGGCTACCCGCCGCGGTGTGATGGTGCAGGCGTCCACCCTGG
GTGCTCTGGAGGCGCTTTTGGAGTTCTTGCGCACGTGTGACCCGCCCATTCCGGTGTCGTGCGTGAACATCGGACCTGTGCACAAGAAGGACGTGATGCG
TGCTTCCGTGCAGCTGGAGCACCAGCCCGAGTTCGGCACCATTCTGGCATTCGACGTGAAGGTCCACAGCGACGCTACCGAGCTGTCTGCGGAACTTGGC
GTGCGCATTTTCACGGCCGATATCATTTACCACCTGTTCGATCAATTCACGGCGTACATGGACAACTTCCGAATGGCGCGCCGTGAGGAGTTCGCGGAGG
TCGCTGTGTTTCCGTGCGTACTGAAGATCCTGCCCAATTGCGTCTTCAACAAGAAGGATCCGATCATTCTCGGTGTCGACATCGAGGAAGGCATTCTGAA
GATCGGCACGCCCCTCGTTGTGCCCTCCGCCGGCGGCTTCCTGGTCGGCAAGGTGGGCTCCATCGAGCGCGAGCACAAGGAGGTGGATCGCGCCAAGAAG
GGCGCGTCCGTGGCTGTTCGGATAGACAACGAGGGCAGCGTCATGTACGGCCGCCACTTCGACCACAAGGACAAGCTGGTCTCGCGTCTGACGCGCCAGA
GCATCGACGCGCTCAAGGAGAATTTCCGGGAAGATCTGCAGAAGGAGGACTGGCAGCTCGTCATCAAGCTCAAGAAGGTGTTCGATATCATTTAGAGTGA
GCGTGTCCCGCAGGAGCGTTTGTGTCCAGACGCTGGGCCAGAGGGTGTCTCCTTGCCGCTCGACGGCGGTGTAGTTCTTGTCAGCGGAGACCGTTTCGAA
TATATGATTACATCTCTTTTCGTCGACATGTTAGAGCTCGAGGCTAGAAGTCAGCGATCGTGACGCCGTGCTCCGGTCACCAGCCTGGACTTCTGTCAGG
CCTGTGGGCGGCAACTCGAGGCACGTCAGGCAGGCGAATCAGCTCCGCCTTACCGCACCGGAAGGAGCAGCACCGGGTGCCTCGGATGCGTGGCGTCGGC
CCGACATATACCAATTGCCCTCTGGTCTAGTGCTCCGTCACAGAGCGTCAGGGCCAGGACGTCGTGACCAGGACGCAGGATTTTCTGCTAGTGCCCAGAC
TGCTACTTCACGACTGCTGTACGGCGCGCGCTGCGTCGTTCTGTGGCAAGAGCGTTGGGCGACTCCGGCGCCGCATATGTGACTTCGGGGCTTGGCATCA
GCAACGTCCAGTGGTTCATCTTGAGGCCTCAGTGCTTGTACTCGTCCCAGTTGCAGACGAAGGCTGTGAATGAGCAGCATCGCCGCATTGTGTATTGTAC
AGGCGAAGTCTCTATACCAGCGTTTGCTAGCGCAACAGGCTGCTTGGGGCGGTGACGAGCCCAGAGTTGAGGGTCGCGACTCGTAGGAGCTTCGCGGCGC
CAAATGGGAAACTGGTAGCCAAAGCCCCCCCATGCAACACGGAATGCCGAGTCCCCACTATTGAAGCTGAACAGATGGAGCGGAGACGAATCTGTCCAGG
AGGGACAGCCGAATGTAGACTTGCGCAAGTCACAGCGCGGCGGACGAAGCGCGCAGAGACCTCCCATCTGAACCGGGAGAACCTCGCAGTCCAGCGCGCG
CTGGCCTTCACGGCGAAGCAACATGCAACATGGAACGTCGGCGTACGTGGAGGGGCTCCTGTTGTGTGTGTTTGTGTGGGTAAGCGCTCTGGTCTGGTGG
TGGACGCGACCCACTGCAAAGGTAGCTGCAAAACGGCGGCATGCAGGCTCGACTGTACCTGCCTCACTTCGCAATTGGATCTCCTCCGAGCAGCCCCGTT
CCCCCCGCCTCCTCCCTACCGCGACGGAATGATGCACAGAACGCGGATGACCCCCATGCAGCAGCTCAATCACCCGGGAGCCGCCTCCAAGTCGAGCTCG
CTCCGCGCCATGCGAGTGCCCAAGTTCCTCCGTAGCCTCTACGACATCCTCCACTACGAGGACCAGTCGATCCTGACGTGGTCCAAGGACGGCACGTACT
TCCAGATCTTCGACACCAAGCGCCTCGAGGTCGTGGTCCTGCCCAAGTACTTCAAGCACGGCAAGTTCGCGAGCTTCCAGCGCCAGCTCAACAACTTTGG
CTTCCGCAAGTGGACCAAGACGCAGTCCAGCGTCTGCACCTTCAGCCACCACCACCTCGTGCGGTGCCACCCGCAGCAACTGGCCGAGTTCATCAGTCGC
CGGCCTCCTGCCAACGGGGTGCGATCCGCAGCCGACGCGTCGTCAACCACCAGACGCAAGCGATCGTTCACGGAGCTCATGCGAGCAGCAGACGTCGGGA
GCCCCGCCTCCTTCAAGACGATCAAGCGTGAGACCGACAACTTCAACCGTGGAGTACAAGCTCAGGAGAGCAGCGCAACGAGCCCCATCCCCGCCAAGGG
CGCACCGCGATGGGCAGCCGACCCGATCGGGTTCCTGAAGGCGAGCGAGGACACCAGCGGAACGCCCACCAGCACCTCGTCCGAACAAACCTTCAACTTT
TCAGTGGAGGAGCTGCACGACATCATCCTACCCGCTCCCCCCATTTCGGAGCGCCAAGATAAGATGCTGGAGCTGCGAATGCTGAACGAGTGTCTGGAAC
TCGGGACCGCGGGTACGTTGTACGCGGCCGCGACTCATGCGGGCGGGGAGCTCTTCCCAACGCTTCCGTACTCGTGGGACAGTGACACATTTTTCGCTCC
GGTCGGCCGTACGCTCTTCGAGCAGGAGCGCGGGCCGTGGAGACTGCACTAGAGCAGCACCCTACCATAGCGTTTCGAATTAGTTAGAGTAAGTAGTAA