Description :
From Genome Similarity Track
Location :
scaffold_654:7284- 14582
Transcript NameFunction/comments
g9711.t1hypothetical protein
g9712.t1 conserved hypothetical protein

Sequence
7298 bases(100 bases per row)
CTATGGCGTCGGTACGACGCCTACTGCTGGCTGGAGGCTGCGACGTGGAAAGCGACTCCCTTCGTCATTTACTCCATTCTTACGACTCAAATGCTGCAGA
CGCTCTCAACCTCGGGCTTCTGAGCACTGACCCGTCTGTTCTGCCTAGCGACGAGGAAGAAAGCAGGAACAGCTCGCAGTCTCTATTGGAGGATTTACTA
CTGTATTTGGTTGTTCGCAAATTTGGAGCTACTGAAGCCTCAGCAGGAGGTAAAGTAATTGTGGGAATTGACCCACATACGTTGGTGCGTTGGCGAGAAA
GAGGCGCACAACAAACAGCAGAAAGTGATGACCTCGTGGAAAGTTTGTGTGGGTACGATAAAAAAGGTTTTAATTATCGAAAATTGCTAAAGGATCTAAC
GACTGTAACTTTGCTTGTACAGGCTCCTGCTGAAGACTGAGTGGGGTGCTGCTGGTGCCTCCACACTTAGTCGAGTCGTTAAGCGTCTGCAAGATCCTCG
AGCTCGTCAACGTTTTCTACTGTTTGCCTTTCAGATACTTGGAAAATTACCGCAGTCAGAAGTTGATACAAAGTTGTTCGACGAAGCTACTCGTCTGTTG
CTACTTGGGGTAACAGACCTGTGGTCAGCAATCCGGAAAGATAGCGCTAAGACTGCAGCTGCTATTGTGTTTGGGCTTTCATCACAAAGCCATATTGAGC
AATTCATGGACAGTTTACTCTGTGTCGCAATCGGTTCGCGGAGTGTTAGCGCTGATAAAAGCCAAGTGACTGCATGGACTGAGAGGGAAGGCGCTTTATT
AGCACTCTCGGGTCTTTTACACTCCATCAAAAGGGAAAATATCACTGAAGAAATCCCAGAACCCAAGGTTTCTCAGGTGAAGGACGATATCAAGGGAATG
TTGGGGATCCGTCCATTAACGGGGAGGTATCACCTTGGTTTGAATGGAAAGCACACTTTGACTCAACTGCCACGCTGTCTGGTACAGACTCTAAAGCCGG
CGATGTATCAATGTCTCCGACATGAACAGCTCAGTGTTCGAGAGCTGGCTGCTGAGTGTTTGGTGGCGTACGTTTCTCTCTGTGAAGAACCGACTCGGCT
CTTGATCTTCCAGGAGGTTATCAGCAAACTGAATCGGATGAATCGGAACGAGAAACTCGGTGAGATCGATACTGGGGCGAATCCAGAGGAATCGGAGCTG
CTGGATGCGTTCGAAGCTGAAGGTTTGCTGGACGTGCTGGCTCGAATGGCTCCATGTCTGCCTTCAAACTTCCTGTTAAAACACTGGAAAGTTATTTATC
CGACGCTGGAAAAATACGTCATGCACATCGCATCAAGCGTTCGACAGAAGAGTAGCAGTGTAGTACGCGCACTGGCCAGTCGCAATCTGAGGGATGAAGC
GTCCTTGGAGCTTCTCGTACAAATGCTGACTTCGTTATCCAAGCAGTTACTGGACGAAAGCAGTCTGTGCTGGCAAAGAAAAGAAGGTCGTCTATTGAGT
ATTGACGTTCTCATTAACGTCCTGGGAGAAAGTCTACTGGGGCGTCAAAGTGCTGCCTATAAGACGTTGAAAAGGACGTCAGAGCCTGTAGAATCTCCAC
AATGCAGATCCGGTACACTTGCCGACTTGCAGACATTCAAGTGGGCGCGTGAACACGCTCAGGCCACGTGGGTGTTACATGAGAAGCAAGAAGCTTCCGA
CTGCATTGATGAGTCTCTTGTCGAGGCAATCAATACATGGATGGAGACAAACAATGGTAAAAATGGCTTGCAAACCTCAGCTTCTGCCTTCTGGCAGCTG
GTCCTGGGTGGGTGCCTTGCGCAGACGAAGGAGGCGTTCGATTCCTCACAATTTGAACTTCGCCGAATCTCTCGCCAAGTTGTTCCTGGCCTAATGAGAC
TTGTCATCTGGACTGATCAACTTGATTTCTTCTCGCCTGCAGCATTTGAAGCTGAATCAAAGACGTCGTGGCCCTGGACGTGTATGAAGTACATTTTACT
GCATCTGCGCTACCTGGAAGAGAGTCGGAGCACTTTGAGTGAAAATGCAGCACAGAAATTGGCAGCAAATTGGAAAAGTGTGTGGAATGGTATCACCACG
CTGGAAAGTAAAATACCGGATGTCGATACGGAAACAATTGTGACCAAAGTGGAAGTGCAAGTGACGGCATTTCTTGCGTTTGGAGCGACAGTGGAGCCAC
TCAGTCAAGTCACTCGCTTTCTGGACAGTGCGTTGCTCTCTATTCACCAACACCTCCCTAAATCAATGCAGATTCAAGCACAAAATCTGGTTGAGAGTGT
GTCCGATAATTCTCTCGATCGGCAGTTTTGCGTCTTCCTCGTGCCTGTGCTTCCAGTTACTATAGCTACACTGCAATACCTGGATGGACGTACTGATGTG
AGTAAATTGGACTTGTCACCGGCTTCTCGATGGTTACTTCTCGAGCGAATTGTGTTGGCCTGGCTGCTGTGCGACGATATGTTCCGGTGGATAACTCTCA
GCAAGGCAACAGCTCAGAATCAGCTATTGGAGAGTCTCAGGCTGCTTCTTCGAGTTCCAACAATTGATTTATCTCAAGCAGAAGAACGTGAAGAGATGAG
CAGAATTTATAACTGTCTTCGCGACGTTGACTCTGTCTTGCAGTCCAAAATGAAAGACACGGTGTACACTTCGTTGCTGGACGTTTACTTGAGGATGTGG
CTACGAGGCATCAAATGCAGCAAAGACACTGGAAATATAGCCATTTCAATCGCTCAATTGTACAGTGAGCGACAGCAACATGTTGCCAAGAAGGAAGGAA
CCAGTTCGTCAAGTCCTGCAACAGAGTCATGGGACGAATGGGATGAAGAAGACCAAGTCCAGCCAGCGACTTCAGTGGTTAAGCTACAAGGGTCTTCGGC
AGACCCGCTGTTTCTAGACGTGCTAACATCTTTAGGCACTGCTGAACGAAGCCTGTTACGTGAGGCAACACGAGGAATCTCTGATTTTAGTGGAAATATT
CCCACGCAACATGTTACTCAGATGCTGCAGCAGATCGAGGCTTGTGCTCAGGTGTAGAAGCATGAAGATGGGGAAGCGTACTGTATATTCATGCACCAGC
TTGTTTCTTTCATTCTTTTATCTACTGCAGTAGACTCAATTCCACCAAGTTCCACAAATGCGCAAGAACTAATAACACGACAAACGCTACCAATGCGCTT
TCCCAAGTGACAAATTCTTGCACCATCCCCTTCATCCTTCCCCAAAATGCCGTTGTAGTTCCCTCCGGCTCGTAGTTTCGTAACACTCCGGGCACATTTG
TCAGTTCTTCATCATCGGAAATGCTCCGTTCCGGCTCGTTGTCTCTCGTAGCTTGCAGGGTGAAGAAGTCGTTGATAATCTGCTTCGACAGCGAAGCTTC
CTCGTCAGGCAGCAGAACTGTCGTGCCCAGAGCTTGGTCCGTCATGGCAATCTCTAACGTCTCGAGTTCTGCTAGTCGAAAGCCGTCAGTGGCAATTCCA
AACCGTCGCGACTTGAAGGTTTTGCTTCAAGATACTTTTTCTCTCCTTGAAGCTATCCTACTTACGGATAAAACCGCAATTCGCGTCCCGTTTTTCGTGG
ATGGAGGAGACAGAAGCTGCTTCTCGACGCACGTTCCGCTTCGTGTGCGGATCTCGTAACGATGAAATTGTGCCTAAACGCGTGACAGAGCCGACACTGA
AGCGCCAGCGTGTGGCTGCACCTTGGATCGTCCAAGTGGAGCTGGTGGAACTCATTTGCTCCATTGACGAGGCCGACGAGGACAACGATAAGCATTACGG
ACTGTTCGTGTGGCCTTCTGCGCTGCTTTTAGCTCGGTTTATTGCTCGAGAGGCGAGTTGGCTCTGTCGTGATAAAGTTCTGCTGGAATTGGGGTGTGGC
ACAGGCCTCCCGTCGATTCTCGCTGGCTTGTGTGGGGCTACCAAGGTTTACCTCACGGATAGAGCCGATGCGGCCGACGTTCAGCGCAATGCAGAAGCCA
ATATCCAGTTGGATGGACTACAAGGTCGTGCTGAGTTCCTCCCGCTTGTATGGGGCGACATGTTCGTCTCAAACGAGCTGCTTTCCGTCTTCCAGACTGT
TGAAGTCGTCCTCGCTGCCGACTGCTTCTACCAATCTGAAGGTTCGTCCATAGTTTCGCTCCTAAATATTTAGTCTGTACTAAAATCTATCACCTTGAGC
AGATTTCGAGAAGGTGATCGCGACTGTCGCTCTCATTTTCCGCTGCAGTGACTCCACTTCGTGCAAGTTCGTCTTCTCCTACCAATTACGCAGTATCAAC
CGGTCGATCGCTCCGTTATTGTCTCGCTGGGGGTTAACAGGCGAGATAATTGACAAAAGCGATCTCCTCAACGACGTAGATAGTTCTCAAGACTTTGACA
GCATCTTCCTCTACGAGGTAAAACCTCCGAACATACACAAACGATAGAAATGGGTGGCTCAGCTTCGCCTTTTATCTTCTGTCTCTCACAGTGCATTTGC
AGTGTTTCTCCAAGTACTGGAGAATGTCCCTCCCGTGATCTAGAGAGCGTGTGCGTGGGGCTCTCGCAGCAGCCTCTTCAGCCTTTCAACGGGAGCTTTA
AACTGTCGCTATTCCCTGACGTAGCGGATCCTTTCGCACGAGTGAGACCGTGGGGCTTCCTATCCACTCGCTAGAGGTCGCTAGTTCAAATACAGCAGGG
ATTCGTTCTCACAGACACTCGAGAGTTGAGAATTGCTATCATCCTCGCCACCAGTCAAAAACAATGTACCTCAAACAAGAACGAATCTGCTCTTCTTCAC
CTCAACTTCTAGAAAATATGCCTCAAATCACAGGGAAGTGTGGGCTTCTGATTGGTTGAAATGCTACCTATTAGCGTATGTGGCTGGTGACCGCACAACT
CAAATCTTCCAGGAAGCGCATCATGTTCGCCCGTGTCGCTCGCGTTGCCACGCTCTCGGCCGCCCGCCGCACGCCCTCCGTGGCGCTGCGTGCGCTGCAG
ACCCGTGAGAAGTCGTCGCTCGCCTCCATGCTCAATGTACGTCGCCAGTTGACTGTCAAATTCGCTGTAAAAAGAGTGCATTTTAACTAAATTTTATCCT
AAATATGATTGCAGCGCGAGATCCAGGAGGAGAAGGCCAACTGCTTCGAGGAGCCGGAGCTGGAGGACCTGCGACTTAAGGTGGAGCAGGTGTTTAAGCT
GCAGGAGGCCCCTGGATGCATGGACATCCTCCTGCAGGGCACTGTGGGTGACGACTCGATCAAGATCAAGTTCAACGCCCAGGACACCGTGGAGCTCGAG
GAGGAAGAGGAGTACGAGGGAGACGAGGAAGAGGAAAGCGAGGAGTACGAGGAGGACGACGACGAAGAGGAGGACGAGCTCCCTGGCGTCCGCTTCACGG
CTGACATCACGCGCGAGAACAAGGGCCTTCAGTTCGACTGTGTGGCCAGCAGCAACCTCACGGTGGAGCGCGTGCGCTACCTGAGCGACTTCGCCAAAGA
GGCCGAGGACGAGACGCTGTACTTTGGCCCCAACTTCATCGATCTGGAACTGGACGTGCAGGACAAATTCTACAGCTACTTGGCCGACCGCAAGATCGAC
GACGAACTGGCTCAGTTCATTACGCAGTTCGCGGACCTCAAGGAACAGCGCGAGTACTTGGGCTTCCTCGAGGATGCTGAGACCTTCGTCAAAAACTAAA
CAACAAGGCAGTAGCGTATTGTTGATACAGGTTTGAGGCCTTTGACCCCCACACACAATAAAACAGTTAAGAGCCTCACTCACCACTTGGCATTTACACT
CCTTGATCGCTAACGCTTTCCTGTCTAAGCTTAACCCTGCATCCGAGACATCACGTTCTGCATGAGCTGCGAGACCTTGGGGTTCGACATGTGGCGCATA
GCGGCGGACGGGCCCTCGCTGTCCACATCACGGAAGAAGTCGGCCAAGTCCGGGTCCGAACGCGCTGCCATGAGCTCTGGGCTGTTCATGAGACCGCTCA
TGTCAGGCATGCCACTTCCCGCTCCTCCAGCTCCAGCACCAGCTCCTCCAGCACCACCGAGGCCTCCCATGAGGTTGCTCATCATGTCGGGGTTCTGCAT
CATATTCTGCGCCATCTGCATCATCTGCGGGTTCTGCATCATGTTCTGGGCCATCTGCATCATTTGTGGGTTGTTCATGAGGTCAGCAAGGCCACCGCCG
CCCCCGCCCCCGCCCAGCATACTAGCGAGATTCGACAGGTCCGGCATGCCTCCAGCACCACCGGCAGGAGCAGAAGCTGAGGCACTAGGTGTTGTCTGCA
CCTGACGACGCTTTCGTTCAGCATCCGCGAGTCCATCACGGCAAGCAGCGTTGGTGCTGTCCACCTCGAGTCCACGGCGGAAGGTGTCAATAGCACCGTC
AAAGTCCTTCAGCTGCACCTGAGCACTGCCCATACGGGAGTAGGCCTTCACGTACGATGGCTTAAGACCGATCGACTGCTCGCAGTGGTCAATCACCTCC
GTGTACTTGCCTAAGTACGTCAACGCTGCGGCCAAATTCGAGTGGTAAATGTGGGACGAAGGTCCGTTCGGAGACAGCTGCAGAGCCTCACGGTAGAGCT
TGGCAGCTCCTTCGTAGTCCTGACCACTGAGTGCAGCGTTTCCCTGAGCCTTCATCTCCTCTGCCTTGGCCTGCTTCTCCTCCTCAGTCAGCTCCGGCTT
GACATCTCCGAATTTCTCCTTAAATTTAGCAAGAGCCTTGTTCGTGCGTGTGGCATGTTCAGCAGTTCCAGGTGCAGCGTCCTTGAAGAATCCCTTGCTC
TCAAGCTTGGCTACCCACTTCTTCCACAGCTCCGGGTCTGTCATAACAAAGACTTAATCAGATTCTAGCTCGAAGATACGATAATATAGCACCAATAGTG
TACATACGCTTCTTGACAACGGGGTCCTCGTCCGCCAACGACTTCTCTCCGGATGTACCCGTCTCCAGGTTCAGCGCCTTGAGCCCAGCAGCGAAGATTT
CCTCGAACGAAGCGTCTCCGTTGACTGCCAGCTGCCGCTTCTGTTCCAAGTCACGCACATCAACGCCAAATGCCTCGCTGAAAAAGATTACATGTAGTTA
GGATATATGGAGCGTTTGTACAGCTTCTACTACGAATTAAAGCGTGCAACTTACGTGAGGCGAGAGAGCGCGGTGTCGACATCTTGAGTATTCACACCGT
TGCGCGTCTTGAGCGCGTCCACCCACGCCAGCGCGTTGAACAGCGTCGCCTTGCTGCCCTCGTCCATCGTGCTCTAAAGGCTATCAAATTCTCCCCTG