Description :
From Genome Similarity Track
Location :
Scaffold_42:7284- 10243
Sequence
2959 bases(100 bases per row)
CGTAACTCTTACTACCAGAGACGTCTTTAAAAGACACGTGTCTAAAACTAATCAAAAGGGGAACTGAATATATTTACTGATTTATAGCGATAATAAACTT
TACTCACGTCTTTAACCTTAAACCTATGCTACCTAATCGAATAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTACGTCACCTCTATGAAGA
CCCTATTACAATCAATATCCTCGAACCATAACCGATAGGGTACAGTTTTATCGCTTAGCGTATGTGATACAAAAGTACGCCTTATCGGTGATACTGATCT
CTTTCTGTGTATACCACACCAATGTACCTGGTTATCACAACCATTTGTGTAACCCCGTTACACCCTCCTCCACCAAACAGTCGATACCCCGAATCGACAT
TCTTCACCTTTCTCATCGAGATAGCTCGAAGAGAACAGATAACATTACGGTTGTGTTTACGACACCTTACGCACCAATGATGAAGTCTTTGCATTCCTCC
GAGTCTTTGGAAGACATCATACGAGAAGAGAACATCGTTGATTATGACAGTGACACTGTCGTCGAAGAGGATGAAATACCCGAACTTGCCACGTCAGCGT
CGTGCAAACCTTCTCGCATAGCGCCAAACCCATTTCCGGAACGAAGCACGGCTCAAGCGCTAACAGCGTTTTGTGCCTCAACTACTCTTGATGAACCTAT
CATCACCAACAAGCTCGATGAGCAACAGCAACGCTATATCGAGGAAAATGAGAGAGCTAGACATCTATCTCAGACATTAGCTATTGCCGAAGAGCATTCG
GACTATCGCTTCAAGCCTTTGAGCGTTAATGAGTTGTTGCGAAAGTTCGCAGGGCAGCCCTTGACTACTTGTCCCACAGGGCGCGAGGCTACGACGTCTG
ACGACATTGCCGAACGAGGTGCTCTCAGAGAGAGATACTTGACGCCCGAAGCGACGACGATCTCCGAATACCAAATCAAGTTAACGGAACAAGCACGTGG
TGCCTCTGTACAGACGCAGAGAACGGTCTCGGTTGTTCTGTACCCAGGTGAGAGTGAGGCCGAGGATCACAGCACGTTCACTCGTTGGGCACATAGGGCG
CATAGGGCACGTTGGTTGCCCAGCATGAGTGACCTTCGATCTAGTGCCTCCAAGGCCGACGTTCGGCTAGAGCGCAAGACGCGCTATGAGTTTGCTAAGG
TTTAGGCCAAAGTCCAGCTACGTTCACTGAATCACACGCAGTACGCAAAACCAGTTGCTGATCCAACCACCACTGTTTCGACTGTGTAGACAGTCGCGGG
TCACTCGGTGTTGGTGAGCGATCCCTACACCCCCACACCTATTGGTGGAAGCGCTTGGGGTGCAAGCTGACCCGCAGCGCGACGCTCAAAAACGTCAACG
GCGTACGGGTAATCTTTCCGAAGGGGTACCTCAAACTTCCATGAGTTTTCAGACTCAGGGTATCCACGCCACTTCACCAGATAATGGTATTGACCTTTGT
GAGGACGCCGCTTCAGAAGTCTCTCCACATGGAACTGTAAGTTCCCTTGCTCGTCGAGCAACGCAGGAGGGGGTCGATGTGTCGACACAGGCTCATAAAG
ACTTGGTGTCAGAGTTGAAGCGACTCCGAGAGTCTTTTGCTCACGTGCTGACAGCACTGGATCAGTCTGTGACTGAGAGGAAGCAACTTCAGGAGAACCT
TGACCAAGTACAACACGCTCATGAACAGTCACTGACTGAGTTGTCTCAGTTGCGTGAGCAGGTTTACCTTCTCTGCTCGATCGACTTGGTCGACAAGCGA
CTGCGGAAGGCGGAGTACAACCTGCCACGGCTGGATAGCCAGTGGAGCGCTTGACGAAGATGCAGCTAGCGGGGACGACATCCCACCCTCAGGCGCAAGC
GCCTTCCCGTCCACGAGAGAAGGATCGTGGTATGGCTTAAGCAAGCCAACGTAAATCACTGGGTGTGTGCGCAACTTGCGCAGAAGATTGAGTGTATAGA
CAAGGCCTTTCTTCGCTATGACCGTAAACGGCCCAATGAAGCGCGGACGCAATTTCGTCTTGAAGATGGTAGACACTACATTTGTAGGTAGGTTTTTAGC
ATTTAATAAGACTTGGTCTCCAACATCATAGAATCAATACATTCTCTGACGTTAGCATCAGATTTTTCTTTTTGGTTGTCTTGGCTATCAGCAATTGCAT
CACACACATGTTGTGAGACACTAAAACGCGGTGCGAGAAAAACTCGCTCACTTGTTTCTGCATCGTGTTAGGGCTGATTTCAGCAATCTTTTCATCAGAC
TCTCCCCCACCAAGCCCAGAACCACGTAGTGGTATCGTGAGCAGAACGCTGGGGTTCGTGAGGCTATTCACATATAAGGGAGTAAAGCCGGTCGAGGCAT
AAACAGCGTTATTCAACGCAAACTCAATGACGAGGAGCATCGATTTCCAAGTCTTAGGCGACTCAGCACAAACACTGCGAAGAACGTCGCCAATGATGCG
GTTGACTCGCTCAGTCTGACCATCGGTCTGCGGATGATCCACTGTGGACATTTCTAATCTCGTGCCGAGCACCTTGAAGATGTAATTCCAAAACTTGCCT
GTGAGGCGAGGGTCGCGATCAGAGATGATTGTTAGCGGCAACCCGTGTTGACGAAACACACGATCAATAAACAGCATAGCTGTACCTTTGCCATCGATGG
AATCCGGCACCGTCGCCAAGTGAGCCATCTTTCTTAAACGGTCAACAGAGACCACAATTCCCTTATTGCCGTCACAGTCTTTGGGAAGACCAAACACAAA
ATTCATACTGATGGACTCCCAACACCCCGTGGGCACAGATAAAATGGCGAGTGGCGCAGCCGAATGTGCTGAGGGTTTGATCCGCTGGCACGTTTCGTAT
GTACGCACGTATGTGCTCACCCATTTGTAGAGTTTGGGCCACCAGTAGTGTTGACTCAC