Description :
From Genome Similarity Track
Location :
Scaffold_208:7283- 12159
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.13DNA ligase
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.14DNA ligase

Sequence
4876 bases(100 bases per row)
GAAATCTCGAGTCTGCGGAGAAGGTTTCAGATTCACTGCCAAGTGCTCTTAGCAACACGTATTCATGCGACGAGTCTAAAAAAAAAACGAGATTCGACTC
GGGAAATGGAAGTAATACCAGTGATCCAGTTGCATCGTCAGCGTGGTTACGCCCACCAGACATCGCTGGAGATTTTCCTGCCGCCCCAGAAGAAGAGAGT
TTATCGCTCGTCCATTCGTTGTTATATGAAGTATTAGAGACGGATGATTATCTGGACGAGGCATCGGACCACCCCACAGAAACCAGCGATCTCGTACTGG
AGAAGATATACTCGTTGTGTCGAGATGTTCAGGTTGCAGCATACGATATGAGTCGTCAACATGGTCTGGATCCATTTGCGATGTTTCACGTTGAAGACTC
AATCAGCTCACCTACTCCTGCGGAGCCACGCCAATCTGTAGCAGGCCAGCATGTGATGGGCTCCTTTGAATCACCTCGGTACTTGGAGCGTGAGCTGAAA
AGCCTTCGCCGCTACTTTCGACCATGGAGAGACTTCACTTTGCATCAAATGGAGGCAAAATGTCAAGTGAAGCTCAAGGCGGCCCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTGTGTGCGACGTTCATCGAGCCCGAATCGAGGCTGAGATCAAGGCAGGAGTCCTGCGAAGAAACTTGGCAGCAACGCGAA
TACAGAAAAACTGGAAGGTGCATCGGCTGAAAATGCTAGTGGCGAAAAGGGAAGCTGCATTCAAATTGATGCACATGGCATTCAAGCGTTTCCACCTGTT
TGTGAGAGTCAATCACTGTCGTCACGTACGCGAGAATGCCAAGGAGAAGATATTCCGTTGGTGGCGCCAGCGTCGTGCCGCAATCCGAAAGCAATCCGCA
GAACGAGCTCGAATAGAGCAAACGCAACAGCGTCAAATGCAAGCAGCAAGAGGATTGCAGCATTTCTTTCGAGAGCATTCGTTGCGTCATCGACTCGCAC
GAGCAGAAGCGCAAAACCAGCAGATGTTGTTCAGAGATCGATTGCGTGCTACCAAAGCACGCCGCGACGACGAGAAACGGCAGAAATTGGAGTCGAAACG
ACATCGAGAGCTCGAATTGAAGATGAAAGTCGCAGTGTCCGACTTTGAGTGCAAGTGGAAGCACGCCGAAAGTGAGCGAACAAAGCTTCTGACCCATCAC
GAGCAAGTTGTCGGGCGATTCCAGCGATTGGAGGGACAGCGACGGCGGCAATGGGCCGAGTCCAAGATCTCTGCACTCATCGAGACATGTTTGCTCCACC
AGAAAATCAAGAGCATTGAAAAGGAGAAAGAGGCAAACGAAGTGCAGTGGCGACTGACGATGCGCGCAAAGGAGAAACTGGAGCTTGATGTCGAGAAATG
GCGAGCGAAAGACAAGGTTCAATTTCGAGTCTTGCAGCGCAAACTCGGCAAACTGGAGAAGGAAAAGGCAAGTCTCGTTGATCGCCAGCAGGTGCTCATC
CAGAGTCATGCGCAGCGACTGCAAACTGTCCGCAAAAATGCTGCGCGAAAAACGATTCAGTCATTTCTTGAAGCACGCCTTGCTGCACACAAATCCAACC
AAGAGCGATTGAAGTTGCTGGCGGCGCAGAAGCAAATTGTTGTGGAGCGAGAAGAGCAAGAGCGAATGGTTTGCGAAGACATCGCAGAGCGTGAGCGAGT
TGCACGTATGGAAAGGATGCATCTGGAGACCCTGCTTCGGCAAGCGCACCAGGACGTCAGCGGCTTAACGATCGAGCAACGACGCTTGGTCGCAGAGAAA
GATCGCGAAGCAGCGAATGCTGCCAAAATACTTGCAGAAAGTGTCGCGGCGAAAAATCGAATCACCATATCCAAGTGGATCGAGCGCCAGATCAGTATCT
CAACGCAGAAGGCGAACGAGAGCAATCTGAAGACTGCGTATGCCCAAGCACTTGAACGCGAGATGCAGCACCGACTCGAGTTAGAGCAACAGCAGCAAGC
ATTGCAGCGGAAACGAGAAGAAGAGGAACATGGTCACCACATCCAAGTGAATCTTGCACGGTTGCAGCGACGCAACTCACAAGGGAAAGCGCAAGCGCTT
TTCGAGAAACGCCAACGAGAGCGTGCGACTGCAGCAATTTGCTCCTTTGTTGAAAGCCGAGTGCAGAGCTCGCGTGCACTGAAAGCTTTGAATGACTCTC
GCCGCCAAGCAGAAGAGCAGCAAATGCGAGACTTCCAATTCGAGCAAGAGGTGCGGAAGCATCTGGTGAATATCATCCTCGATACAAAGTCTATCGTGGA
GAAGTTGGCGCGTGAGAATACTACTGCTGCTGTGATGACTGTGGATCGATTACATGCATCGATATTGTATCGGTGCTCTCGGCTGAAGTACCTGAAGGCT
TGCACACTCGCTCGCTGGATCCAACGCCGTTGGCGTATGCACCAAGTAGAACTCGCAAAACGGCGAGAAATGGAGCGTATAAGGACCGTGAAGCTGGATG
CTCTGCGTCGTCGTGTACATGCTCGAAAGATCCAACGGAGATGGAGGACGTGGCGTCACGAAGTCGAGACGCACCATGAAACTGAACGAGCGAAACGAGA
GAAATGCGATTCGTTACATCGCCGTGTTTGTGCCCGCAAAGTCCAATGCTGTTGGCGACTGCACTGGGTAAAGGTCGAGAAATGCCGAGAAATGAAGCGT
GTAAAGATCGCAAAGCAGGACGCTCTGCGTCGTCTCGCGTGTGCTCGAAAGATCCAGCGGAGGTGGAGGGCATGGGCGCATGAAGTCGAGATGTGTCGCG
AAGCTGAACGAGAGAAGCGTGAGAAGTGCGATGCTTTGTATCGTCGTGCTTGTGCTCGCAAGATCCAACACCGTTGGTGTATGCACCGAATGGAACTCGA
GATGCAACAGGAGATGGAGCGCATGAGGACTGTGAAGACGCAGGTACTNNNNNNNNNNNNNNNNNNNTCGTCGTGTGCATGCTCGAAAAATCCAAAGGAG
GTGGAGGATTTGGCGGCATGACATCAAGACTCGTCGTGACGCTGACCGAGTGAGACGAAAGAAGTACGATGCGTTGTGTCGCCGTGCCTGCTCCCGTAGA
ATTCNNNNNNNNNNTGGCGTCTGCATCATGCAGAAGTCAAGGTACGCCGAGAATTCGAGCGTGTGAGGACTATGAAACTGGAGGCGCTACGACGTCGTGT
ACGCGCCCGAAAGATTCAACGGAGGTGGAGGGCGTGGCGACTGGAAGTCAAGACTCGTCGTGACGCTGAACGAGTGAGACGTAAGAAGTGCGATGCTTTG
TGTCGTCGCACGTGTGCTCGCAAAATCCAACGCTGCTGGCGCCGCCATCAAGCTGAAGTCAAGACACGCCGAGAGTTTGAGCGCGTCAAAATCATGAAGC
TAGAGGTGCTACGACGTCGTATACACGTTCGCAAGATCCAACGGAGATGGAGGACATGGTGCCGTGACGTTGAAATGCATCGTCGTCTCGAGAAGTGCGA
TTTGTTTTGTCACCGTGCATGTGTTCGTAAAATTCAACGGCAGTGGCGATGTTGGCGAGTGGAGAAAGAGAGGCGCGAAGCACTCGGGAAGCGAAAGCAG
GAGCTGCTTCTGATCATCCGATGCAGGGTTGGCGCTCGTAAGATCCTAAAACGGTGGCGGGCGCAGCGAGCAGAGCTCGAGAAAGTAATAGCTCGACAAG
AGCGAGCAGCTCAAATATATCGAAGAGCATGTGCTTATAAGATCCAACAATGCTGGCGCCGATGGCAGCAAATGGTGCGATTATGCCGAGATAATGAAGA
ACGTCGACGTGTAGAGCAGATTGAGTCCATTCGTCGTCGAGTTTTGGTGCGCAAGATACAGAAATGGTGGAGGCAGATGCTGCTACGCAAAGAGCGCCAA
CGAGCAATGGAGCAAGCAGCTCTGCGTCAGCAAGAGGCAGAGACTGAGCGGCGACAACAGCAGGCTGAGTTGATGCGCGCACACTGCTGCGCAAGAAAGA
TCCAACGCAAGTGGCGTCAGTGGCGTCAGTGGCGTATTGAAGTCGACGAACGCCAAAAGGCTGCGAAGAAATTAGCTCTGGAATGTCTCGAGGCAGAAAC
TGCGAAGCTCGTGCAGATGGAATGGATGCGCTGTCGCGCATGCGCTCGCAAAATCCAGGGACGGTGGCGACTCTGGCGAGTAAAACTCGAAGAGTGTCGA
CTTATTGCAGAACAACTTGCCCGCGAGTACAGTCAAAAGGAAACAGCAAGGCTGGTGAAACTAGACTCTCTATGGTGTCATGCCTGTGCGCGTGTAATCC
AGCGACACTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCAGAGGAAAATGGAAGCGTATCAGAAAGCTGCTGTCGACCTTGCTATTGAATA
CGTCGTGGCAAAAACAGCAATACTTTGTAAAGCAGACGCTATGCGCCGTCATGGCTGCGCACAAAAGATCCAGCGAGTTTGGCGTCACTGGCGAATACTT
ACCAAGGAATGTCGATTGGTGGCAGAACGAGTATCTAGTGAATGCCTGGTCGTAGGGAGAGACACAGTGGTGGCGGTGACATGCATGCGGCGTCGTACTT
GCGCTCGTAGTATCTGGCGACACTGGCGTCAGTGGCTGGTGCAGCGCGAGGCACGTCATCGTGCAGAAGAAGGAATCGCTGTAAGCCTGGAACGACTTCG
TCGGCGAATTTGTGGCAGTCGGATCCTGAACAAATGGAGAAAATGGCAGCAAAACCGTGAAGAAACTCGCATTGTGCGCGCTGCGATTTTGATTGAGACC
GTGTGGTGCGGCTTTCACACTCACGAGCAGTTTAAAATTCTGAAACACGCGCGGCACCAGGAGGAGATTCGGTTGT