Description :
From Genome Similarity Track
Location :
Scaffold_1018:7280- 9056
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1018-snap-gene-0.3Myosin

Sequence
1776 bases(100 bases per row)
CTTTCCTGGTTTCTACCCAGACACGTACACGGGCAAGATCTGTATCGCGGTGAACCCGTACCAGTGGCTGAACCTGTATGACAAGTCCGTCATGGACCGC
TTCAGAGACGGCAAGCGCGAGCAGAAGCCTCCTCACGTTTACGCCGTATCGATGGAGGCGTTTTTCAACATGCGAAACAGAAAGGAAGACCAATCGATTC
TCGTCAGCGGCGAATCCGGTGCGGGTAAAACCGAGACGACAAAGATCGTGATGAGTCACTTGGCCGCGCTGGCGTCGAACGCTGACTCGAAGGTCATTCA
GCAGATCATCAAGGCGAACCCGTTGCTCGAGTCGTTTGGTAACGCAAAGACTGTCCGAAACGACAACAGTTCTCGATTTGGTAAGTTCACAGAGCTGCAG
TTCACGCAGGATGCGATGCTCATTGGTGCTCGCTCGCGAACGTACCTTTTGGAGAAGTCGCGTGTGACAACCCAAGCGTCGGGCGAGCGCAACTTCCACA
TTTTCTACCAGCTACTGAGCAAGCGCGACCAGTATCCTGAGCTCGAATTGCCAGCGAACAAATTGTTCAAGTACGTCTCCGAAAAAGACAATGAAGTGCC
TCTTGACGAAGAAGGTGATCTCGATCGCACGCGCGAAGCTTTGGAGTTGATTGGCATCGAAACCAAGCTTCAGCAGGAAATCCTGCAGATCCTGGCTGCT
GTTCTCCATCTCGGCGAGACCAGTTTTTGCGCCGCAAATGGTGACGTCGATGCATCGCAGCTTGTCGACTTACAGCCGTTTGCCACTGCCTGCAAACTGC
TTGGTGTCGAGGTTTCTGCGCTTGAACGTGCTGTGTGCAACCGTAACGTGTTTGTCGGCCGCGAAGTGTTTTTGAAGCCAATGACGAGCGACCAAGCGAC
AGACTGCCGAGATGCGTTGGCGAAGAGCCTCTATTCGAAACTGTTCTTGTGGCTCGTCGACCAAATCAACGAGACGATCGGTGTCAAGACGAAGGAAGCA
GTCTCGTTCATTGGGATCTTGGATATCTTCGGCTTTGAGCATTTCGAGCACAACTCATTCGAGCAGTTCTGTATCAACTACGCCAACGAGAAGTTGCAGC
AGAAGTTCGTCCAGGACGTTTTGAAGACGGTGCAGTTGGAGTATGAGGAGGAAAACATCTCGTGGTCGCACATCCAGTTTGCTGATAACCAGGATGTGCT
CAACCTCATCGAAGGTCGCTTGGGTGTCATCAGTTTCCTGAATGAAGAGTCTCTCCTTGTCACTGGTACGGATGCCGCGTTCGCGAGCAAACTGGGAGCA
GTCATGGGCAACAACCCATTGCTCGAGACGCCTCGACTGAACCAGGTCGCGTTCTCGATCTACCACTATGCCGGAAAAGTGACGTACGACGCGACTGGAT
TTTTGGACAAGCACCGAGATGCGATTCTGCCTGACATCAAGTTGTGCATGAGTACGTCCACGCTGTCGATTTTGTCAAATACGTTTGCCGATGATGCCGC
TGGAGCGGCACCTGCTGCTGCTCCCGCGAGAGGTGCTGCTGGAAGGAAGAAAGTGCAAGCACAACCGAAGCGAACTACGGTTGGAACTCAGTTCAAGGAA
AGTCTGTCTCAGTTGATGGACAAGATCAGTCTGACGGAAGTGCACTATGTGCGCTGTTTGAAGCCAAACGCGCTGAAGAGTGCGCACTGCTTCTCTCACA
GCGATATTGTGAACCAGCTTCGTTGTGCGGGTGTGATCGAGGCAATCCGTGTCTCACGCAGCGCGTACCCAACCCG