Description :
From Genome Similarity Track
Location :
Scaffold_1451:728- 3715
Transcript NameFunction/comments
Phymu_g13298hypothetical protein PHYSODRAFT_328401

Sequence
2987 bases(100 bases per row)
TCAACTgtggcctccagcgccagATTCTGCCATTCCAAGTAGCGACGAGATCCTACGGATACAAACCCGGAGATCGCGGCACCTTTTCTTGATCCAACAC
CAttccgacgtggaggcgGTGATCCAGCCTCAGGATCTTCTCACTAAGGTTCGTGATCCTGAGAAATCGGGTCCGTCCCGGACCATCAACCACGGTGGGT
ACCCACCGCGCGCCTCGGGTCACCCAAAGCTTTTCTGTGGCGGACAGCTTCAATCTGGCGGCTGCTTCCTCCGATTCTCCAACAGGGATCTGTAGATCTT
CCTCCAGGGTGACCGATCTCACCTTGTCTCCGTATAATCTTTTGCGACCACTAAGCGGGATCCCGACTTCATCGGGTAGACACATCGATCCCTTAGCTAG
ATCCATCCGGACCCCGGCCGGGATCATAAAATCCATGCCCAGGATCGTATCCTGTCCCGAGAGATCGCCGATCCATATGTCGAAAAAGTAGACCAGATAT
CCTGCCAACGTGATCTTGATCCTCGTTCGACCCTCTGTGGTATATACGCTATCGCCAATTCCCACACATTCCTGTCTCTGACTAGTGTCAAAGTGGCACC
CAACCTTACGAGCAAAGGCGGTATCCAATATGGATACCTCGGCACCAGTATCCAGGAGCAAGATCGACTTCTCATGGTTGATCTTGCCTGAGATCTTGGC
TTGTCGAAACCACTTCCCCGGTGCACGATACTTCCAGTAACCCCGGGACTCTCCATCTTTGAGATCCAGGGCCACCTCTGTACCAGATCGGTGGAACTCA
TCAATTCGAGGGAGATTCATGATCTTGGCGGCGTATGGATGCAATTCACATGTATTACCGCGTAGATCAGACTCCTCCCTACCTTGATCTGTCGACTTCT
TGTTCACGTATGCATAGATGCAGTATCTAGAACGCTCGGCTNNNNNNNNNNNNNGCCGATTACGGTCGGAGGGGGTCCAATGATCGGGGTTCCGGCTTCG
ATCCTGCGTAGGCGGGCGCGATCGCGCCTTATCCGGCGGATGAGGTTCACCTCCCGCGGTGATCGCCGGatcatcagctgcagcaaggTAGATCCTCCTC
AGGTCTCCCTCAGAGTCGGATCCGTCTGATCCGGACACCCCTTCTGACTCTGAACTCGGATCATGGGTCTGGATCGCGCAGACTACCTCCCTGGCGGGTG
CCGTAGGCGTACTCGCTGGGGTCTTCTGGCGATACTTCGATCCATACGCAGATCGACGTTGTCGACTCTTGGCCCACTCTCGAGCACGGAGAATTTCTTC
GAGATCGTCGACATCCGACAACCTAAGAAGGGTCAAACGATCGGCCAACTCGGGATCACCCAACGTTTCGATGAAGTGATCGACGTGTTCCCGGCGGGCC
TTTGGGCCAccgtccttgatcttcagTTTGGCTCGTAGAGCCGCCACGTTCAGTCGATAGAGGTAATCTAACGGGGTCTCCTCAGATCGCTTACGTGCAT
GGTGGTACTGCTACGCTACGGACATTCCCAAGCCACAATATTGCGTTTGGAAACTGTCCAGTAGATCCGGCCACTTAGTCTTGGTCGATCTACTCAGCTG
CCTAtaccagttcttcgctggGCCGATCATCAGATCCGCGAAGGTAAGACACTTTTCTTCCTCGGTGGCCTGATCCCGCTGGAACGCGGACTTGACCTTG
CTGATCCAGGATCGTGCTCGATCTTCGTCCAGATCCTTTCCGGAGAACTCCTTCAGACCCGAGATCGCCGAGATCCGCACTCGCTGGATCAAGGATGATC
CTCCTTGGCCGACCGCGGCTGTAGCCACCGCCGCACGTCCCGAGCTCGAGATCTCCAGGTCATCGGGGTCATACTCCCAATGACAATCCGGATCTCCAAC
CGACTCCATATCTACGTCTTGTGTTCCAGGATACCTCGGCAGATCAGAGGTACGAGGGGCTGCGGTCActtgctcctccttcagaAAGCGGCTCATCGCG
GACTGGAAGTACGCCTCCAGTTTGCCGGTTGACTCCGTAGATGTCGGAGCAGTCGGGATCCGATCTGACGGCGGCGTCCACTCTGTGGTTCGCTTCGGcg
aagatctggatctccgATCCGGCTGAGGATCTGGATCCGGAGCCTTCACGCGTGATCTGAGCAGTTTGGCCCCAGAGGGACCCAACGGTATTCGTCGCGG
GCCACGAGAGCTGTCTGCGTCGGGCTCGGACGTAGCGGACGCATAATGCGACGATCCCGTCTGGTACTCCGGATCCTGCGTTTGATGGCGTTCTCCGACT
AAGATCCTAAGAGTCTTGAAGAGATCTTGGATCGCGGTCTGGATCGCCCCCAGGCCCAAGTCGAACAGGGTGCCTGGATCAAACGCTCCGGCCACAAGAC
CTGCTTCGCGAAGCAGATCCAACAAAGCCTGCACCGCACCCAGGCGGTCAGTCACCGCAGGCGGGTTCGACACGGGTCCTCTCAGGTCCCCGATCTGGCG
GACTTGTATTGCCGTCAGCACCGGATCCTGGATCAGGATCTCGCTGAGCACCTTCTGGTGGTACGCCAGCNGtggccttgatcttcttcttctttgtagA
TCTTGGGGTCACAACAGACTTTGTGAGCGACTGAGGCTTAGGCTTCGCCTTTACCTTATCCCTCGGTGGATCTCGATTCTCATTGAGATCCGTAATGGTC
CCCGAAGGGACCGCCGGAGGAATTCGAGGTTTCTCTtccagatccggatcttGATCTAGATCTGGATCCGAATCTGGATCTGCCTCGTGTCTTTCAGCCG
AGCTCCTCCCGAGGCTCTGTTGATCTGTGGATCTTGCTGTATtcagcggcgtcttcgtcgatccAACATCCGAAGGCGCTTCTTCCCCTTGTTCTATCTT
CACTTTAATATCTTCTTGGAACTCACGGTGATATCCGAAGTCACCAGAAGATCCGGGCACGCGCACCAttgtggtgtagcgggatca