Description :
From Genome Similarity Track
Location :
Scaffold_1:727848- 729012
Sequence
1164 bases(100 bases per row)
TCGTCCTCTTTCCCTCCCGTAAGGACTACAGTGTGGTAAAAACCGGCAGCAACCAACGCGACTCTCTTCCCCACAAAATCGTCAATAGGAAATGGGTACA
CCCGTTCAGTCGTATCCCCTGTACCGCCCGAAAACGTACATAACGCCGTTATCCGAGACAGCGATTGTATGGTAACATCCACATGCTATACGGACGATAT
CTTTCCCTTCTAACTCGTCAATTAACCTCGCATTCGAGAATCTCTGCTGCTGAAGCTGGAGATTACTCGTCGAGCTCGCATTCGAGCGACCCAGACCCAG
TTGGCCGTAGTCATTCCGCCCAAAGGCGAACAAATGCGCCCCACTACAGAGAGCTATCGTATGGTAATACCCGCATCGAATCTCCAGACATTCTTGGCGT
TCCAAGCCGCCTCGTACCTGTACAGGAGCGAGTTGGTTCTCCATAGTGTCAATACCCAATTGACCGTAATCATTTTTCCCAAAAGCGAAGGCTTTACCAC
TAGCTGTGACCACCATCGTGTGGTATTGTCCACATGCGACCGAAACGATTTGTTGGTCACTCAAAGCTTCGACGAATTGAGGAATTTTACGATCAATGGA
GTCATTGTGACCCAATTGGCCGTAGTCGTTGCGTCCAAAAGTGTACAGATTCTGCAGATTTCCGTCCTCACAGGCCAGCACAGTATGGTAATAGCTACAC
GACACCAGTCGTACAATTTTATTCTCCAGACTTCGAATAATCTTTGGAACACTTTCGCTTGTCGTGTTGCCGTGCCCCAATTGGCCACGATAGTTGTACC
CACACGTCGCTACCCGTCCATCCGTACTGACTAGAATCGTATGTTCGCATCCATTGTACGCGTGAGCTTGAGAACTCCCACTGTCCATCTTTGGAATTTC
GCTTAAATGACTCACTCGAGCGGTCCCTCCTTGTCCACATTGGCCATTGTCGTTATACCCGCACGTGAAAACTTTGCCGTCTGCAGTCAACACGACCGTG
TGTTCGTTCCCAGCGCCGATCTGAATAATTTCCTTCTGTTGAAGTGCCTGGATCCGCTCGAAAGATTTCCGTGACGCCGTGTCTCCATGTCCGAGTTCTC
CGTACGAATTCTGTCCACAGCTCCAGACTTCTCGTTCGCCCTCGTCTTCGTGGAATATCGTCGT