Description :
From Genome Similarity Track
Location :
Scaffold_20:72767- 74176
Sequence
1409 bases(100 bases per row)
CACAGTAATGGGCCTATTTTGGCTCACTACTTTAGCTTACACGTGTGCGCACGTGTGTGAGGAACTGTAGCTTAGTTTAAACTAGAGTTAATTATTCTCG
GGCCTCCGAGTATGGGTTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGACCTGCTATTTTTGTTTTATGCTTTCTGACTTCCTCTA
AATGTAATATTCTAATTTAGGAATCTGCCAACGGTTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGATGCTTCTTTCAGCCAAT
AGGAACCCTAAGTCTCTATGGACCACCCGTCATGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTTACACCAAGATCGAAAAAGTCTTTCGAACCTC
TAACAGGCGCCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTAACCCCCCGTCAAGGTTAGACGCGACGAATCACGGCA
CGTCAATCAAGAAATTGACCACTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGATCGCCGAAGGAGAAGACCGCCGCT
GCAGCAAAGGAGAAGACCTCCGCCGGGACAGAGAATCTCTCTGTCCCCGAGTAGTCAGGAAGCAAAGCGTGACGCTCTTGCTGCCAAGGCTGCGGCGGGG
ACAACCCAGCCCGGGATCGTCCTCGAAGGCTCTTCCGTAGTCAACGACGCTATTGACTACGAGGACGGAGACGTGGGGATGGAGGAGGGCGAGGCCTCGT
CAAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCACATGCCGGGTCGAAACGCCCTCGTGAGGAAGACGACTCGGAAGCTTCGAGCTCGAA
GCGTTCGCGCGGCGAGAGTGACACTCCGCTCTCTGCTGCTGGGGCTTTCAGCTCCCCAGGCGCTACAGCGACTTCAAGTTCTCCGCGCGCTGCTCAGGCA
GCGCGCGATCCGTGGATGCCGTCCGCGACTGAGATCGCGGCACGGGTGGGCAATACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGCATCC
GCGACGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTAAATCGGGCTCTTCCATGAGCTCCGGTATTTCTCCAG
CAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAGGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAATCCGACCGCTTAC
CGCGAGCGGGTTAAGCATGCCCGTGAACGCTTCGAGACGTTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCAT
GCGCTGTGC