Description :
From Genome Similarity Track
Location :
Scaffold_23:72766- 74926
Transcript NameFunction/comments
Physo_537034protein tyrosine phosphatase, receptor type

Sequence
2160 bases(100 bases per row)
CTCGCTGCCAGTGTCCAGCACGAAAGTGTTCTCTGTGCAGACGCTGTGTCGGAACGACTCCGGGCGCGATCTCCCCCAAGATGATCGCAGCGCTGGAACC
GTACGAAGGCGTCACAAGCGATCCCTCTGACAGCACGAAGTCCATGCTGAATCTAGCAGGCGTGCTAGCTCGCAGCGGTGAGGGCCACGTGCTGAGTCTG
GAGGACGGCACGAGTATCCGCATCACCACCGCAGCGTTCCGGATAGCTCAGACTGTCTTGGCGCAGTGCAGCATCCTGGAGTCACCCGAAGGCGTCAAGC
TGCAACGGCCGTGCTCGTGTCCTGTGCGCTCGCTGGGCGATCTCTGGGTCAAATGGACCACGAAGAACCACACGTTCTCGCGCGTGCCGCTGAGCGAGGA
CGAGGCGCGGCAGTTCTCAGCAGGAACTCGGCAGATGATGGACCAAGACAAGAACGAAGACGGCAACACGGTCTACTATATGACGCTCAAGTGGCACGCG
GCGGCCAAGCCCCAGAAGGGCGACACGGCCAAGATCGCAGCACGTCGAGCGCTCACAGCGGACCAGAAGAAGCAGAATGCCTTCTTCCTTGGTCTGTGCA
AGAAGTACTGGCAGAAGGCCCAGCTCCGCGTGGCGGAATATCTCCAGAAGACGCTGGCGGCGGCTGCAGACAGCGCTCAGAGCTCGGGCAAAAGTACGGC
CGACGTGGAGATGCAGGCATTGAATCGTCTGGGCGTGCGACGCATGCTGCAGTGGCTGGAGGAAGATGCCGAGGCGGTGGAGAATGCTCGTCAGGAGGAG
GCCCGTGAGAAGGCCGAGGGCGGAATCGTGGCGCACAACGCGTGGGTCCGTCGTAAAGACCGCCTGCGCATTCGGATGCCGACTCCGGAGACGACCGACG
GAGCAAGAAGACCTGCTCGACATGCTCCACCGCCTCGGTTTGACTTCTCAATGGGGTCCGGTGTCGTCCGGCATAAGCAGCCCTGCCGCCCTCCAAGCTC
CACGGCAGAACTCATGCGCAACAGCGGTCTCAAGTACGTGCACGCCATGAGCGAGGGCTTCCAGGGTCGCGGCGGTGATCTCGAGAAAAGCAAGCAGCTG
CTCGTTCAACAGGGCCACGTGCTGCGCGACAACTTCGACCAGGACGGCGGTGGCGACGACGACGACCCCGACTCGAACCCGTTCTCCAAGGATCGATACC
TCTTTGAGCGCCGTAACAACCCGGCACTGCGTGGCAAGCTCGAGGGCGATCGACGTCGACGAGAGCAGAGTCGAGAGAGCTACGCTGCGTGGGTCGCGCA
CAAGGCGATGCGAGATAAGGCGGCCAAGTTCCTGGAGCACCTGCCACCGCCGAGGGACGGAGAAGAGGGCGACCCAGTTATCGACAACAACGCGAGCTAC
GAAGACGACTTCGACGATTCAGGGCGAGGGCCCGCGACGCCGGCAGCCGTGAGGTGGGAAGAGGTCGGCAAAGCGCTCAAAGCGGTCGATCGCACGCTGT
TGGACGCGTGGGTGCGTTGGAGTCGCGGGTTCCGCAGTGCCGGTCGATGCCGCGCACTCTGGGAGAGCTTCGCCCCCGTAAGTTGTGACGTTCACTGCGC
GTCGTCGCCATTGCGTGACGTTTTCCTCAAGCTGCTTCATCGTCCGTCGGGCGTCAACTACAAGCAGGCGTGCGTTGAGCTTTGCACGCGGAAGCACAAA
CAGGCACTGGCCCGTGGCGATGCCGTCGACGAGAACGGGGAAGAGCTGGACGAGGACCTGGAAGAAGCCAAGCTCATAGCGCGATACGGCTTTGTGACGG
GTCGTGAGCTGGCAACGCTGCTGCGAGGTCTCGGGCTTGTGTTGCAGCCCGAAGAAACTCAGCGACTGGTTGAGTTCTTTGCCGACCCCGAAGAGGCCCA
AGGTGATAGCGGAGCAGTTCGTCTCAAACTTGAGGCGTTCTTGGCTGTGGTCGGTGACGAGCGTCGCGCGTCGTGCCGTGGCGACACGGATCAGTTGCTG
AGCTCCGTGTGCATGTGGGAGACCGTGTGTCATGAATGTGGAATGCTGAACGCCTTTCAGCTGGTGCTGGGCACCGAGGGCTCCAGTCGTCGACGTCGAG
CCGAGTTGCCCGGCCACGTGTGCAGACGCGAACAGTATGGCGGCAGATTCTCGTGCACTC