Description :
From Genome Similarity Track
Location :
Scaffold_32:72737- 75649
Transcript NameFunction/comments
Phyca_LT153434093flagellar associated protein

Sequence
2912 bases(100 bases per row)
gttatcttccgagttttcgtagtcatcaaaccccagcaccttgtcagcaaaggctagtgcagtgtattgtgggtccatcgataatccaccagtaccgtca
ccagtggcaagcaatgcggccaaacagctatgcagctcttcttcactcataggctcaccagactgcaacaagcgagcttcgagctggccccattgtagtg
acgatgactcctcgtctttgtcgtcaccgagatctttagccgctgaagcgatgatcttgaacgcatgttcgatctgcgctttgccaactccgaagacggg
acgatgattcacatacagcttgatgaaatcgtgaagaccaatactctcgactaggcgggacgtttcggtaaagcgtgaatagcggacctcacttaccatg
tgctgtatctcttcatcggtaggataaaagcccagtgcgcgcatcacatttgatatctcgcgcagtggaatttgggctgttatttcgcgggcagcagtgg
agtcctctccctgaacacgaagttgagccaagtagaagtaatcgacaatttcgtggtaaaatgatccttctcgaccaccttccagcagtgctagatacgg
tgcaagagccatgtcgtcctcatccagctcgtcctccaccactttttctttgccaagctcactcactacctcccccttgaccgtccgaggcgttcctcga
gcctccagtaaatctagttggtgagtgtgaatctcccacatgttcaccacaagatcgtctccacctgcagtaagcaaatgactgccgtcaaacgtcacat
ccacattgctgatcttgcctggatgcgctatgagacccatggcccggtgcggattgccatcaagaggaagtttgagcagcccaacaaccttttcatgagt
actgtaggcacagtagcgctcagcaacaccacctgtagtctctgcagcaatttgatcgacttctcggagcggtactggtaccaaattgttaattggtcca
ccgtaagagggacctagcgtcgttttccggcaagtttggttgccagtgttccactgcttgagtttgtattcgtcatttgccacgataaccaaatcttctt
gcacaccgcgaagttcagggtgccaacagcaagcagtgggaacagcgctttgctctacacgtgtaggagcttgtttaagaaccacgccatccaagatact
cgatcgctcaagacaatactcagctagagtgcgatcctcactcacagaaacgagaactggttgtccatcaccgtcccgagagaactgaagtccagttatt
ggttttgaatgagctcgacaccgccccagatacacccactcatcaacatcatctgaactatcggggtgagctgtcacttgctttgcacgccacataccca
ggaaaaggttagcgtctaacgctacgaagagcgacgagtcaggactgactaatacatcggttatggcagctttcccaagacgaaacgaagctaaatcatc
cagccgatgtgcatgaagcactttcacaactccactggtaaagccgactaccagttttcgcccatcacgagcaaacgtcagacattgcggacggagtttc
tccgaatcgaatcgtcggaccatgatcagacgcttagcagagtagtcccaaagctgcacaactccagaataggaactaagcgcaagctgtgggagtcttg
gatgcgaagcaagtccgtgaatggagtcattaattccttgcataagtagtgtgccacgtcgtctgtcaggttcgtgctctccaaacaacgttgcgctcat
gccaacgatgaaagcagacgctgtcgaaacaataaagtcgggaacgtgaaaagactcactgtcggcatcatcacccacacgtgtgtcatcattaggattg
ttatcatccgttgtagccggtaaagcaaaggatacactggtgacaggaccagcattcaaatcctcgaaccaagccaccaaacggaagtcaaagtcataaa
accgcacagcaccatcactggagcctaaaacaagataaccatccatatccacgaccacagtcagagctaccttgcgctgtggttcagctccgcctgcaag
acgtacaatcttaacagccttgcgctccggaaactgccagcaggaacctcagcgtcattatcactttgaactgcatcccaaagcacgagatctccatctt
cggtcccagtcagagcttgagccgagtctggaacaaacaaggactgcgtgaagccaccgacaacttggcggaagtctttttgcgctagagaaggagagta
gaatagcagtgagcgggctgcccagctccaaaaaatcacacgttgacggccggtagtaacgagttctcgaacgtcgtacgtattgaagcgaactccgtgc
tgcacgtcctccgtggccacgagtgacgagtacaatggcttcgagaccgagtccgttgctggagctgcccattcccaaactgccagctcttggtcaaact
tctttcgagctgttgtcttgttcccaatagtagtttcgtcatcacgatcaactgcactcagcgtcacgagaaagagtgcatcaggtgatatgtcgatggc
ttgaacaccgtttgcatgcggccgaaagatggtccgaatgggattgccggactgagcgtcccatacaactagcatcgactcttggccgcgatcagctgtg
acaacccagcgtttatcttcgctgacaacgcagcacgaaattggatgacagtgtccttgcagcagacgttgctggcggcgagcatagtcatatataacac
ccgtgtgcgctgcagcatagaatacagcacgacgtgtcccggttgataaactgtggacaccgttgatcaggtctttctgaaaaccgaatgtccaagacag
cttcagtgcatt