Description :
From Genome Similarity Track
Location :
Scaffold_105:72727- 80622
Sequence
7895 bases(100 bases per row)
GCCTGGAGCTCCTTGACGTGAACTTGTCGTCGTTAACCGCGGTAGGGCCCATCACAACAGTCATAGCGTGGCGCAGTGAACCTTCAATGTCATCGCAGCT
CGTTCCGGAGTCGGGTGCGACGTTTACGTGATCATCGACCCAGTGGTAGTTATAAAACCTGGTGGGGTATGCGGCATTTGTGCACGATCCGTGTATGAAT
GCCACCGCACCGCCCAAGATGCTGTACGCTGCGGAGCTACCGGTCCACCCAAACGCGAACGAGAGGTCGATGGCGATCGCGTTGTTATCGAGGATGTGAC
CCGCAAACAAGAACACGCACTTGCTGTGAGAGCACGCATTACGGTAGGCGGACGCGACGTCGCCGGCCATTAACTGGACGGTCTTGTCTGGGGATAAACG
GCGACACCGGATGATTTCCTATGAAACGCTTGAGCAGTGCTCGAATGATGCAGACGGGATGTCGTCCGCATTAGTGTGGGAGCTGAACGAATCTCCCCCG
GGAAAAGAGAGGTCGTGGATAACACTACCCGAGACGCGTAGCTCGCCGTCGTCTTTGTCGGCCATGCCGAAGGGGCAGATGAATAGCTCCGGCCAAATCA
TTTTGATGTCTGCGTCTACAACGGTATAGCGAAGGCATCCTGTTCTTTCCTTATGTCGGCTCGTAAAACATGGATGCGTTGCGGAGCGGACGGGTGGTTG
CGGGGAGCGATCGCTGTGGAGGAGGTGGGGAGGTGAGGCGCACGCGGGAACCCTCGACAGCGATTCGCAGGAGATCGTCGACATGATCATATCCTTGGCA
ATACGCCCGCAGAGTGTCAGGCGGTAGTGCTTTATTGAGCCGATAGGCTGTGGGTGACTGGCAGCGAATTTATTTAGTGAACTGTTTGAGGGGCATTTGT
GTGCGCCGGATAAACGCAGAAATTACGTGTTGCATTAGTTTTGCGAGCATGTCGCGGCTGGGTGCCGATTCTACGGGAATGGCAGTGTGCCTGACGGGAA
AGTGCATGTTGACTTTGCGGAATGCAGTGGAGAGGGACGCGTCGTGGAAGGATCTCGCGCGCTAGAGACCTGAGACGCGAATCCGTGTCAGCGTGACGGC
GATGGGCGTAGAGCTTGTTTGTTCCCTTAGGTTGGGCGCTAAAAGACTGCAGCACAGGAAAGCGTGGGGGGGCGAGTACGCGGATGAATGCCGGCCAGCC
GTAATGCTGTGGCTGTCATCGGAAGGCGCGTGTGTGATTAGAGTAAGTAGGAGCTGGTCGGTGCTCGAGCCCAAATCTTCAGTGGAATGGCAGCTCACCG
GCATATGGCTGAAATGGTTGGATTGGTGCACACGCATCGACGGCAAGGTCTTTGCTGGCAGGGTTGTCAGGATTCACGTCGGCAAGTGTGTTGGGCTCTT
GAAATACGCCGTGTGGTTCACTAGAACTCAGATTGTCAGTATACGTGTGTGTATTCAGATTACGGCTGAGGCTGGGGGTACCGAAGCACTGGCGAACCAG
CAGTACCTCGGCCGTATCAGGCTCAGCGCGGGTCGGGCGGCTGCCGTCGGCCGAACCTCTTGGTGGCAAAGCTTACCAGTGCAGCAGGGAGCTCGTCTGG
TCAGGTGTGTTTCCGGCCCGCCGCGCACGTGTCCGGGTTTTCACCGGAGCACATGCCCCCACCAAATAAACGTAGAAACGGCTTCACGCCATCCGTCATG
TGGGATGATGGCGCGCACGCTGGCTGGAATGTCACTCGGGCGAGAAGGCGGACGTGCGTCGTCACCTCGGTCCACACGGCGGCTGCGTACATGGGGCCAA
ACGTCCGCGGAAGGCGCGTTTGGGCTGGGCAGAGCTGTCGCGGTATGCGTGCCGCTGGTATTGGCGATATCTTGGAGAGCCGTGGCCCGTCTAATGGACC
TGAACTTAATTCGCGTTGCTGTGGACGAAAACACCCGCCACCAGAAGGAAGTGTCGCTAGAAAGATGAACGTACACAGACCCATTGTGCTGGTTTACCTC
GTGCAGTGTCCGTTGCGCGCGCTGCGGCGTATAATTGGGGTCCGCGTCCATGTTGGCGACGCCGAATTCGCGAATGTGGTGCAAAGGGCGCGTGAATATC
TCTTGCCACTTGGCGTGCGCAAAGATGAGCAGACTTTGCACCGCTCCGAGCAGGCCGTAGTACGTATTGCACGCTGGGGGCGAAGGCGGTGCGACGTTAG
AGCCGAAGTCAAGGGTGAGGTTGGTGTCGGACGATCCAGCTTCGAGCTGCGTTGCAGATTCGGCGCGGCAATAGTGCATGATGAACGCTCGGCGTCGGCC
AACGCGAAGCCCCGCGGTAGCTACGATAATCGTTGAGTGGTCGTCGAAGTGCACGCATTCTAACATGCGCATGCATAAGACAAACGAAGTAGGCGTCTCG
TGCTCACCAGCCGGTGTCTGCCAGTAAGCGTATGCCCTGTGAGAGGCAAGGCTATGGACGGCTAAAGGTACGAAGACTCCTCTAGTGCGCAGCGCCGAGG
GTGGGAACTGGGCCACGTGCAGACCGCGCACGGCTTCGGGTGGTAGCAGACCGCGAAGGTTGACTGATGTCCAAGAGGAAGGTATCTGTACGGCTCCCAC
GTCCGTGGTGGCGGTGGTGAGGGATAGAGGCTCAGGCACCGTTCTTCCTGGACGGGCTTGAAGGAACTGCAAAAATGCCGAGAACAATGAGGCTGGATCG
TGTGTTAAGTTCGGGAATTTACTTGGGACGGGGGCTGTGCCGGACTGGGGATCTGCTGGGCGGTTGCTTTGCTGGACAACCGGAGACTCGACCGGCCGCA
CGGAGAGGGAGGGGGCGCTAGGCGTGGCCTGGTTGGAACTGGCGTTGAAAGTGCTGAAAAGAATTGGCGAGGTCAGATGGCTCAGAGAGAGAGAGACCGC
TAGTTCAGTGCCGAAGGTCGTATGGCGGGCGGCTGCGGGGCCACCGTCGCTCCCGATGTGTCACGGAGAGTGGGCGGCGATGGGCGATTGTGCAAGGCCT
GACTAGGCGGCGGGCCGCTATCCGGCGCCGACGTGTCCATGATGGAAGGGTCCCAGGCGACGTAAGGTGCGCAAGCATGAGTGAATTCGCTGGATGACTC
CGGGTGAAGCCCGGTGGCGGTGGTCTGGCGGTCGCTGGTCGCTGTGGCTCTTGGTGTCAAACGTATAGGTACTGGGGGCGACACCGCAGCATGTCGGTAG
GGTACGAGCCGGCGGGTAGGTGTGAGCCGATCAGGCTGGGAGGGCGCTGGAGGCGTGGTCATCACCGCAGGCTGGGAACGGATCCGAACGGAACTGAACG
TCGGCGCTGACGGGGTGGCGAGTGCCACGGCGGATGCTCGCGCTGCCTATGCTGTGGCCTCCTCCTTGTCGACTGCGAGACTCTTCTTCTGGCCCCGCGG
CACAGCGTTAGTCGCCGCACTCTTCTTTCTCTTTGCGATGCGCATACTCGCACGGACGCGCGCGTCCGGTGAGCCGGCTGCTGGCGTGAGCGAGGCCGTT
GCGGGAGCTGTCGATGGCGGGCCTGGCACCGGGGTCGTGGATGGATGAGCCGAGGATGGCGGGGAGACCTAGACCATAGACATCGCTGAAGCCCGAAGCA
GCGCGGTGGGCGGAGCAGTCGGAGCGGTTACTGGCGGCCCGGCCTGGAAATAAGGCGTTTACATGGAGGTGGGGGGGCTGGACGGCGCTCGCGGGGGACA
GAGGCGACAGCATCGGCACGGGCAGAGAGGTAATTATCTTGAAAGCTTGAGCTGGGAAGCGGAGACGCGAGCTGCAGTCGTGCTGCTCTTGCTGCAACTG
GAGCCGTTGTGTCTGGTCGCTATCTATTCCGAAACCTATGTTTCAAAATCTTAAAATTGAGGCAGCAGTTGGGACGACGGTGCATTCGGTTAGCCTGTCC
TCACGGGATAATGCAATGCTAGCAGAAAAAAAACCAAACAGGAGCCCAAATTGAACAAAGAATTGCCGGAGTTATCGGCATGTTGTCAGATGTTGCTGCT
CGTAATAAGGAAATAGCGGAGGAATACATTGCTGCGTATCAACAAGTAGCTACTAGCGAAGAAGGTCAAACAGGCTAAAATGATGAAGAAAATACCCACA
CGAGACTATTCGGCAACGTTCAGGTGCAGACGCGCAAGTCTCTGGAGAACACGCATAAGCGGTAGTTGGAGCGACGTCAGGATCAGCAGTCAACGACATA
GGCGGTTGGCTGATTAAAAAGTTCTTTTGGGATGATAGTGGGAGTTAAAAAGTATTGGTGAAAAAAATCGAGCATGCAATTGCAAATTGACTACCAGGTC
GGCCACACCATCACCTTTAGTACGGTACCGGTCCCGAATACATGTGCTTTGTTAGTATTATTTGGGCCTTAAAATGGACAATTTTTTTCTATTTTTGGGC
TCCATCGTGGAAGTCGCAAGTCACTGGCTGCTCTTGAGTTTGTGGTTTACGCGCTGTAACACAAAGCTAAGCAACTTCACTTTGCTGCTCCACATCCTGC
TTAGGTTCCAGCAGGTTCGGGCTGAAGCTGCTTACCATCGCTAAGAACGTGTTGGGGTCTGGCGCATCGTGAAGCTCAAATCTCTTGCACACACTGGATT
CGGGGCCAACTACCACAAATACTCGCTTCACATCCTTCAGTAATTTGTGTTTATCCAACATATCTATCAGCCCAGCTAACCTTATTTCATTGATGTTTTT
TTTCTCGCTACTAATCGTCCACTGAATGTAATTCAAAACTGTCTCTGGCATTTCGCTTCCACATGTAAGCGCTTCACACGTGGTCACTGCGTCAGTGAAA
GAGAAAAACGGGTATTTGGGATGCCAGTAAGTGTTCTTCCTAAGTGTGGTCAAGTAGTCTAGGCATGCTTTCTTGCAGAGCTGTGGAAATATAGACTGTT
TATTTATTGTTCTCCACGATGCATCACAATTAAGAATTGCAATTTACAATCTCAAGTGGGATTATTGTCAATAGATTGGTGCACCCATTACATTACGTCA
CTGTCATCTACGTGGTTGCTCTACTCTGTATTCATGGCGTTTTCAATTGCAGCTGATACGGACCCGAGTGTAGCCAGGTCCCGGTCTAGCTTTAGAAACA
TTACCGTTTCCAAAGTTGACGTACTCATATTTTTCCGTAGGTAACCTATGGAGCTTTTGACCATCGAGAAAATCGCTCCGCCACCCCGGATGTCGCCGGA
ATCCAGTTAGCTCTGGTGTACTTGGACTCCTTTGTCCCGCGAATTTTAATACGTGCCTTCTTAGCGATGGCTTGGTCAAGCACCTCAGCAGTTCTCTTTC
GCTTCGAGCGCGACGCTCGTACAGTATCTCGCTGTTGGTCAGAGATTGCCCGACCGGTGAGCGCAGTAATCGAGCAGCTGCATGCCTCTCTGTTGCAAGC
ATCGGTTTTTTGGCTCCACATTGAATCTTGGCCAACCCTGCTTCAAAATCTGGACACTCAACCACTTCTCCACCAGCGGCCAAATAGTAATTCATGTCAT
CATAGTCATCCAAAAAAATATCAAATATGTCGCGAATGGTAGTAGCTGTCATATCCTGACGTTGAAGCCGGCATGTTTTCACTTCAAAAGCAGTCATTTT
GTTGGGAAGCGCGAAGAGTTTTCGCTGCTCACTTGGTAAGGGTATGAGGCCAACAAGTGGACTACGCCGGAGGTTTTCGGTATTTATATTGGTAGTGGAG
TCGTCACCGTCACTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTGATACTAAGTTCCTTATCCAAAGGACAC
TTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGG
TAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGAGACCTTGTTAACTCTCCAAC
TTATGTACTGAGAATTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACACTCTCCCTCACTAAGATGAGAACAT
ACTGTTCTCGAACTTTCCTCAGCGAGGTCACGTCCTGTCAAGACGACGGAGGTCACTAGACCTCACCTCTGCGTTCTGCAGCTCCACGAGCTCACAAACG
CGCTCGCATCCTTGATGCCTGGCACTTCCACTCCGGCCCACGGCCCAACGTCTCCAGCGCGTCGCGCCGCCCCTGCCTCGTCGGTCCCAGACCCCCAACT
GCGCTCCGCAACTGCTCCAAGAGCATCTTCGTCTCTTTCGGTGGCACAGTACCACCAAGAGTATCGCCGTCGCCACGGTCAACGCTCCATGAGCCGTCAA
CAAGAAGAGAGCAAAGCTCAAAGCTCGTCAGAGCCGCGGGCGCCGCCCAGAGGGAACGATGTTCTGTTCTCGGAACTCGAAGAGGGCGAAGTCGATTACG
ACGAGCCCATGGTTAGTGAGGATCACTCCGGACCAACCTCTCCGAGGTCGCACACTGGTGCCGCGTCTTCCCCAGCTTCCTCTGTGAGGTCTAGCCGCTC
AACGGCGCAATCTCAAACAAGAAGAGACCTGCGGACACCGCATCCGTTCTCTGAACGTTCGAATCCGATTCGCTCGTTGCGCGATGCGCCACCGCTATCG
TCGCGGTATGACGAGGAAGATCGATACGATCACAACGTCATTACGAATGACCTGGACGAGGCCCAAGGCCGTCAGTTGTCCAATGAGCAGCGCTCGCAGT
CGTTCCGACCTGTGGTCCGACCACTTGTTCTAACGTCACGCCGTGACTACGGCTTCCAGACGCGGAACTTTGCCGGAGCGGCCCGCCTTTCGGCGCAGCA
GCCGCTGAACACGTACACGTGTGGGCCTGCGGCCTCGCCTGCTCATGAGCAAGTGCAGCGGCACCGGCTCCGAGAGCGATCTCTGACTCCACAAGTCACA
ACTCCTCAGGAGTATCAGGCGCGCCTGCATATGCAGCTCAACCGCCAACCGGTTCCCTCCATGCGAACCATTCCGGTTGTTCTCAGCCCGGGGAATCCTA
GCGTGCTTATATAGCACAATTCCGAAGCTGGGTGGAGGGAGCTCGACGGCTCCCCTCCTACAATGCTCTTCGAGCAAGTTTCTCTGAAACTGATATTCGT
CTTGAGAGACGTTTGCGCTTAGACTTCGCTAAGTCGAAAGCACGTCGACGGACACTGGGACCCCGTCCCCATCACCTCGAGGCGTCACCACCTCTTGCTC
ATGCTGCGAGCACCGCTCTTTCCTATGAGCCGGCTGCTCCAGCCACTGGTCGGAGCTTGAGCTCAGCCACCGACCTGTCATCCCCGCGTTCTAGCGGCGG
GAAGCGCTCGGCGCCTGACGACGCGGTCGTACGCCGTAGCGGCGGGGCAGTGAGTCTGCCCGATCAAAAGCGTCGACGACGTCAGGGCAGTCCTGCCGGA
GGACAACCTCAAACTCCCAAGCGTTTTGTGAGTGAGGATAACCCCTCCATTTCACAAGGTACTGAGTACGACCCTGGCGCATGCGCCTCGCCATCAGGCG
TTCCACATGGAAGTGGAGCTCGCCGTGCTCATCGAGCAGAGCAGGAGGAGGCCGAGCCTCAGCTGGACTCTCGCGTCGCGAGTCGCAGCGACGTGCTCGC
GCTGGAGCAGCGTGTGGGTTCTCTGAACCGGTATCTCCATGATACGACTGACTCTCTGAGTCGCCTTGCAGATGGTCTCGATGAGACGAACCACCGCGTG
GACTGGTTTGAGCAACCACAGTCGGTTCAGAACCGAGTCGCGGACCTTGAGCGTCAAGTCGCTCAGCTGCAAGGTCAGATCGACTTGCTGTTGCG