Description :
From Genome Similarity Track
Location :
Scaffold_4:72710- 76776
Transcript NameFunction/comments
Physo_315905microtubule-associated protein, putative

Sequence
4066 bases(100 bases per row)
ACGGTAAAGTGCGCATTTGGAGTCGGAGGCTGGAACCTGGCGCTCAATTCGACTTGGTGGCACTGGGTAGCTCTGCTCCCCGGGTCCGCAGTCTCGTAGC
TTCTCCTGATGGCGGCGCAAAACTGCTAATCGCTACTGCAGGTGCCGAGATTTTTGAGATCGCGTCAAGTGACGGCTCCAATCTGCACTTTGGTCCTGTA
GTCTGCGGACACTCGGCGTTCCAGCTTCACGGGCTCGCTGTGCATCCACTACGGCGCGAATGCTGCTCGGTGGGGGACGATCGCACCGTGCGTGTGTGGG
ACCTCTCTGCCCACCGCCAACTACGCGTTGCCGCACTTGATGCTCCCGCTCGAGCCTGTGCGTACTCACCTGATGGGTCAAGTATTGCTGTGGGCCAAGG
CGTTGATGAGGAGGAAGACGAGACCCCGACAGTGACAGATCCAGATTTATTGGCGTGGCGTCGGCGACAGCAACCCAAGTTGGTGAATCCTAACAAACAA
GGGGCCTTCGCAGTGCTGACGGAGTCTTCGCTTGCCGTGAAATTCGAGGCCAAGGACTCAAAGAGACCAATTCGAACAATGCGCTTCTCCGGAGACGGGC
TCACTCTGGCTGTGGGGCCGAGCGACAACTGCATCTACTCGTACCACACCGAAGACTGGGCGTCCAAGGGTAAGTGTCGTGCTCGGGATGCCGGAGTTAT
CCTCAACACTTTCGACTTCTCGACGACTGGCGAGTACATCATGGCCAACGCCCAGAACCGCGGCGAGATGGTGTTTTTTGAAAGCTCCTCGGGCGTTGAA
ATCACACGCGTAGCCACATTGAAGGACGTCGAGTGGCTGTCGTGTTCGTGTCCGTACGGATGGGGTGTTCAAGGAGCTTGGCCGACTCGAAAGATGCAGG
CGTACGAAATCTCGGCGGTAGATCGCTCTCCAGGTGCAGAGAACCCGATGCTCGTCTCGGGTGACACGCTCGGTTCCTTGCGGCTTTTCCGGTATCCATG
CGTGAACCCCGAGGCGATGTGTCAAGTTGCACGGGGTGCCGCTAGTACCATTTCCACCGTGCGCTTTACCGCTGATGGAAACTACGTTGTGGCTAGTGCA
CGGGACGAGCGGTGCATTTTTCAATGGCGCGTTGAGCGTGAAGAAATGGATGTCGATGGAGGAATGGCAGGCAATGGGGACGGTGACGATGTAGCTGCTA
CGTCTGATGATGAGCGAGAGACTAGTCACGGAGGAGAGCGTTCTCCGTTTGACGAGGCTGTGGGTATCGGCGATTTCGCGCTTGAGCTGTTGGCAGAAAG
ACTGCAGGATCCGACGATCAACCAGGAAGATGAGGAAGTTCCGACCGAAGGAGACCCACCAAAGTCCAGCTCTACACCACCCACTGCTTCAGCCCCTCCT
CCATCTAAGCCGTGGGCCAGTAGTAGCGTTCCGCCTTCGGAGGCTCCAGATGACGGTGACTTGGAGCTCTCAACTGTGCCTAGTGACAGCCTCGAACTCG
AGTGGGTCTACGGATATCGCTGTCACGATGTCCGCAACAACCTTTTCCTGACACGTGCCAAGGGCTTAATGGTCTACCCTGCAGCAAACGTCGTGGTGAT
ACTGGACAGCAAGCTCTGGCTGCAGCGCCACTTCAAACAGCACACGGACGAGGTCACGAGCCTAGCAATTCACTTCGGCCAAAGCGGTAAACCGAGCAAC
GCTGCGCTGGAGGTTGCAGCATCAGGACAAATGGGGCGTCTTCCAGTCATCCATGTTTGGCGCATCGACTCGCTCGAAGTACTGGCATCTCTACGCGGAT
TCCATCGTCATGGTATTGCCGAGCTGCGGTTTAATTCGGCGGGGAACCTGCTGGCGAGTGTTGGGCTGGATGATCGCAATTCACTGGCGCTTTACGACTG
GCGAAGTGGCACACTGTTGGCACATGCAAGCACGACGTCCGTAGGCCGCATTCTTGGCGTGAGTTTTCAGCAGGAGGCTGCTACTAAGAGCGCTGCACCA
GCATCTGATGACTCAATCGCGCCCGGAGAAGCACCGGTAGTCCCCGTCGTGATCGTGACTGTGGGCGTCAAGTCGGCCTCTTTTTGGCGTCTCGCAGCAG
GCCAGACTCTTGTCAAGAAAGACGCTCTACTCGGACGCAAAGGTCGACAAGGAGGCTCGCCTCCTTCTTTCCTGAGCGTCATGTGCTGCGGCAAGGACGC
CATTGCAGGTACAGTCAGCGGGGATTTGTATCGCTTCAAGGGTACCGAGCTCTCCAGTATCGTACCAGCTCATACGCGAGGAGTGGCAGCCTTATACTGT
TCCTCATCAGCCTCAGGAGGGATTGCTAGTGGCGGACAAGACGGCCTCGTCAAGCTTTGGAGTGCTGACTTGGAGTGTCTAGCCGAGTTTGGGGAGTTTA
ACGCGGCGCACCACGCAATTCGCAGTGTTTTTTGGGACTCAGCACGCGAGATGCTGCTCGTTGGCACGCGAGGCAGCAGCATCCACCTCCTTTCGTCGCT
TGATGGTGCGCCGGTGGGTATGAAAACACCAGACGGCACCCCCGTGACATCGTTGGAGACCCATGCACGAGGTGAGCTGCATGGACTGAGTGTGTGCTAC
TCCAAGTCGCGAGGCTGCACCACCGGTGACGACGGTGTACTTCGCATTTGGGACTTGGCTCATCACATCGTGGTGATCACCAGCAAACTCGACACTAGTA
GCCGCGCCTGTGCGTACTCCCCGGATGGGGATTTCGTTGCTGTGGGCTTGGGGAGCGGAGGAACTGGAAGGCGACACAAGAAAGACGGCAGCATGCTGGT
GTTTGAAGACCGTGGACAGAGCGTGGAGCTCGTGTACGAGACTCGCGATACAAAGCAGTCGGTGACGGTTCTCCGCTTCTCTCCTGACGGTCAATCGCTC
GTCTGCGGGGCGTTGGATGGCTCTGTGTATATCTACGACGTGCCCAGCAACTACACCAAGCGAGCCGTTTTCTCCAAGCACAAGGCCCCAGTCACGCACC
TTGACCTGGCGAGCGACTCGCAATATGTTCGCAGTAATTGTCGAGGCTTTGAGCTGTACTTTGCGGATGTCACCACCGGCTCGCACGTGGCCAGCGCCAC
AGCGCTTCGCAACCACATCTGGGACACCTGCAGCACCATCTACAACTGGTCCAACCAAGGGGTTTGGCCGGTGGCCCCAACAGGACTTGGTGACGCTGTG
AAGCGGGAGATCACTTGCTGCGCCTGCTCGTTGCCCGGCGCCCCTTACCAAGGAAGCAATGCCATTCTCGCAGCGGGGAACTCTCATGGAGCAATTAGCA
TATTCAAGTATCCGAGTTTCGTTCAGGGGGCTGGTGCGAAGACCTACTATGGACACAGCGGTGCTGTCGCTCAATTGGGCTTCTCGGGAGCTGGTGGGGC
AATTTGCCTCAGTATCGGTCGCTCGGACCGCTGCATGCTTCAGTGGCGACGGCTTTATGGAGCTGGAGGTAGTGCTGACGTCCCATCTAATGGAAATGCT
AGCATAGTGAAGGATCCTGAGGACGACGCCGACTTGGAGGCTGAAGGACGTTTCCTGCCCGAGGCGTTCGTCAACGATGGTGGAGGCGCTCAAAGCGAGG
TGAAACCATTCGTAAGCGCCATGCTGCCTCCATCAGGTGACGTGCAGGAGCCCAGTGAAGCGGATGGAGTCGCTGGTCAACGATCATTTGAGCTAGAGCA
CGTTTTCGGCTTGCGGTCGCACGATGCCCGCCAGAACGCCGTGTACGCTCGGCCGAAGCGGATCGTTTATCCGACGGGGTGTGTCGGTGTGAGTTACGAC
CGACGTGAGCACCGACAGCAGTTCTACACGGGACATACGCGACCGATATTGTGTGCTGCTGCATCCCCTTGTGGAGCTTTTGTTGCGTCAGGAGAAATTT
GCGCCCAGAACTTTGCGCATGAGCGGCCACGCGTCCACGTCTGGGAGCCGGCTACTTGCACGCGGGTGGTGGAGCTCAGCGCCTTTCACAGTAAAGCTGT
GACCGCTCTATCCTTCAGCTCCCCCGATGGGAAACTCCTCGCTGCTGTGGGTCAGGATGAATTCCA