Description :
From Genome Similarity Track
Location :
Scaffold_173:727- 3489
Sequence
2762 bases(100 bases per row)
TTGTTCGATGGCGTGACAGCTCACGTGGATGGTGAAGTTGGCCTTGCAGCCCTCCCATAGTTAACTGCTCTGTTAGAGCTAGACGAAATGTCTGATGGCG
AGTTTAGCCAGGCCTTGAAGGCAGGCGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCAAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCT
AGAGGACACCAAGGCGGCACTCAGTGCCAGAGTAGATCTTCGATCCTTAGAGATCCTTTGGATCCATTCTATCCTTTGGTAAGGAAATTTCAAGATGTGA
TGTGTCACAACCCACCATCTGTCTTACCTCCCGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCC
TTTACATAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAGAGTAAGTCGCCCCATTCCACACCTACGTCTTGTGTCAA
AAAGCGTAATGGTAAGTGGCGTATTGTGCCCACTTATAATAAGCTCAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGAATGCTCTTCAG
AACAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATCGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGATTA
GTACCCCGAGGGTATGCTCTGGTAGTGGCTCGTTATGCAACAAGGGCTGTCAAATGCCCTGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCT
CATCGAGGCTATGCACAAACGTGCTTTGATGATATCTTTGTCCATAGTTGTGCAACGAACGGTCGAACTGATGTGGATAATCACATTGATCATTTACGAG
CGGTGCTCGAGTGCATGCACAAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTTACTTTCTGGAGTGCTTCATTGGAAAGC
GAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATAGTCAATTGGCCGGTTCCAAAGAACCAGACAGATCTACGTAAGTGGCTTGGCCTTGCCAATAA
CTTGCATAAGTATAGTGTGAATTACGCAGACATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAGCATTAG
GCTTTTCAAGCAGTTAAGGAAAGTATCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGCGTCGTCTGTGACGCATCTGACTTTG
CCATAGGCAGCGCTCTGTTACAAACAGATGTCGATGGACGCGAAAGCGTCATTGCATTCGAATCTAGACAGCTCAAAGCTGCTGACAAGAACCATCCAGT
TCATGACACGGAGCTACTTGCTATGAAGTACGCTCTAGTCGAATTCAGAGTACATCTGATTGGCTCAAAGCCATTTGTGATCTACACAGATCATGCATCA
TTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAAAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGCGAAGTATAAGCCAGGAA
AGCAAAATGCTCTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGC
TTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTCCTCTTGGGAGCGAGGAGTCGAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGG
CTACATCCATATTCTATCGATAATGGCCTGTTGTGCTATCGCACATATATTGAGGATAACCCTCATATTGCTGTCCCTCGTGATGAGGAGTTGAAGTATC
GAATCCTCTATGAGGCACATGATACCGCTTTAAGTGATCATCTCGGTCGTAGAAGACCTATAGCTCAGTGAGCCAGGCTGATTGGTGGCCCAAACTATAC
AAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGTGGCGGCGCTGCTGGTTAGTCTGCCTGTGCCCACGG
GGTGTTGGGAGTCCATGAGTATAGACTTTTTTGTTTGGCGTACCGAAAGATTCAGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCGAGA
TGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGATCGTGTGTTTTGACAACATGGTTTGACAGTGGAAAT
TGTCTCTGACAGAGATCCCCGCTTCACTGGGCAGTTTTAGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTTGACATGTCCACAGCGGATCATCCGTAG
ACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGCTCCATGCTCCCTGTTG
TTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTATAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCTTCGCGTTCGGTTGACGCTACCACT
ATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGGTGATATCAGCTCTGCTACTATTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGA
GTGAATGTCTTAAGACATGTGCGTGACGCAATGACTGAAAGCCAAGACCGACAAAAACAATA