Description :
From Genome Similarity Track
Location :
Scaffold_3106:727- 2735
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3106-fgenesh-gene-0.0Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16

Sequence
2008 bases(100 bases per row)
CATCTACCAGTGCCGCGACGAGCTGCTGCAGGTGATCCGCGAGAACCAGATCGTTGTGATCGTGGGCGAGACCGGGTCAGGCAAGACGACGCAGCTGACC
CAGTACCTGCACGAAGAAGGCTACTCGCAGTACGGGATGATTGGCTGCACGCAGCCGCGCCGTGTGGCGGCCATGTCAGTCGCACAGCGTGTGAGTGAGG
AGATGGGCGTCGTACTGGGAGAAGAAGTGGGCTACGCGATCCGCTTCGAAGACCTGACGTCCGACAAAACGATTGTCAAGTACATGACTGAGGGCGTGCT
GCTGCGCGAATCGCTGCGAGAGGCGGACCTAGACACGTACTCGGCCGTGATCATGGACGAGGCTCATGAGCGTGCGCTTAACACAGACGTGCTATTCGGC
ATCCTGCGCAAGGTGGTACAGCGCCGCAGTGACTTTAAGCTCATCGTGACGTCTGCGACGCTCGATGCCGACAAATTTGCGAGCTTCTTCGGCGGCGTGC
CCATGTACACGATCCCAGGTCGCACGTTCCACGTCGAAACGTACTTTGCCAAGTCCCCCAGTGAGGATTACGTGGACTCGACCGTGAAGCAGGTGATCCA
GATCCACCTGTCGCACCCGCCGGGCGACATCCTCGTGTTCATGACGGGCCAAGAGGACATCGAGGCCACATGCTACATGCTAGCCGAGCGCATGGGCAAG
GTGGACGGCGCGCCACCGCTCATGGTGTTGCCCATGTACTCGCAGCTACCTGCGGACCTGCAGGCCAAGATCTTCGACGCGTCCGACATCCGCAAGTGCA
TCGTGTCCACCAACATTGCCGAGACGTCGCTGACTGTGGACGGCATCAAGTACGTCATTGACTCTGGCTTCTGCAAAGTGAAGGTCTACAACCCGCGCAT
CGGCATGGACGCACTGCAGATCAGCCCCATCAGCCAGCAGAACGCCAACCAGCGCGCTGGCCGAGCCGGACGAACCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTACCGCATGTACACGGAGCGCCAGTACGTGAACG
AGATGCTCGAGGCGCAGATCCCGGAGATCCAGCGCACGAACCTGGGCTACATTGTGCTGCTGCTCAAGTCGCTGGGCGTTAAGAACCTGCTCGAGTTCGA
CTTTATGGACCCGCCGCCGCAGGACAACATCACGAACTCCATGTACCAGCTCTGGGTGCTGGGCGCGCTTGACAACACGGGCGAGCTGACGGAGATCGGG
AAGAAAATGGTCGTGTTCCCGCTGGACCCACCGCTGGCCAAGATGCTGCTCTTCAGCGAGCAGCTGGGCTGCTCCGCCGAGGTGCTCGTGGTCGTGTCCA
TGCTCTCGGTGCCCAGCGTATTCTTCCGGCCCAAGGACCGCGAGGAGGAGAGCGACGCCGCGCGCGAGAAGTTCTTCGTGCCGGAGAGCGATCACCTGAC
GCTGCTCAACGTGTTCAACCAGTGGAAGCAGAACCAGTACTCGAGCCAGTGGTGCTCGGACCACTTCATCCACGTCAAGGGGCTGCGCAAGGCGCGCGAG
GTGCGCGAGCAGCTCGTGGACATCATGAAGCAGCAGAAGGTGGCGCTGCGCTCGTGCGACGGCGCCTGGGACGTGGTGCGCAAGGCCATCTGCTCGGCGT
ACTTTTATAACTCAGCGCAGATGAAGGGCATCGGCGAGTACGTTAACATGCTCACGGGCATGCCGTGTAACCTGCACCCGAGCGCTGCGCTCTTCGGCTT
GGGGTACACGCCCGACTTTGTGGTCTACCACGAGCTCATCTACACGACCAAGGAGTACATGCAGTGCACTACGGCCGTCGAGGGCGAGTGGCTCGCGGAG
CTCGGACC