Description :
From Genome Similarity Track
Location :
Scaffold_70:72698- 74012
Sequence
1314 bases(100 bases per row)
AGCGGCATACAGCTGCATGCATCAGTATGCAAGTTGAAGTTCGAGTCAGATTTGTGAAGGGCGGCTTGTGCCGACCCACTTGCACTCTGCGGAAGTAATT
GCTGCACATCGTATACATGTACTCTGTATTCACTGGATCGACCGCGAAGCAGCGCGCTGCCTTCTGCCAAGCAACCGCCCTCTACATACAAGGATCGCGT
GACGCCCACCAGTGCCACCACTTCAATCTTCACTTATTTGGACGTCAATTCCACATATGCAACTGCATTTTTGGCAGCAGCACGGAGCATACTACTTTTT
GATATCGAAGGAAATCCCGGACGATGTACTGCAGCTCGCCGCAAGCTACTCGTACAGTTAATTAAAAATACTTAAGTACATGTAGGCAACCTTCCCGTTT
AACATTTTGGTGGTGGTGATGGTAAACTTCAACGTTGAAGCGGGCGGCTGCCGTCTCTGCACGAAGCATCGTGAAATCAATGTCGAGTGTACATAACATG
AAACTTACCTGGCGCTCAAATTGAGTTGACAAACTATAACAAATTTCCAACTCTATAGTACGACTCGTGAAGTTTGGCGATCCGCGAGAATAATATTTTT
GCCAATATACCGTGAATCACGAGCAAATTGGGACCTTTAGAGCTCCCGGGTACTTATTAAATTTAATATAGGCTTACCGTAAAAATATTTTTTTTAATTT
GGTGGTAATTCGGTCAGTAAACAATTAATCTGCAGCTTATAGGACTGATGAGTCAGTAAATACAGACGAGCTCCTTACGAGTCGTAAGTTACGACTCGGG
CTTAAGATTATATGCGAGCAAACTGCTTCCATACTGTATATGGACTCAAAAGGTGGCTCACCTCAATAGACTCGGAGGATGTGGACGTTTGCTCCTTCGT
TCATATATTTGTTTTAACATATAATTTTAGTCATTTTAAAAATCATCATGATGTATGGGCTTCTCGAAGTTTCTACAAGCGACTACACCTACTGTAGCCA
GCAGCGAATGCCGCCACCGCTTCATTCTTGACCAGCGATTGGATCGGAGAATTCGTTGGTACGGCCGAGCATCGAGATGCGCATGGTGCTGCTACCATAT
GCCCCCGTCGTTGCTCGCGCTGTCAAGAACTCCTTGAAGTGACCGCATTGAAGCTGGCTTCTAGAACCACGGTCAGCTTGTAAGACAGGCGAATTCGCTG
CGTTGGCATCGTACAGCATCGCAGATAACGATTCGCAGCGCTAACACTGGCATCGACGGCGTCTTCTAGAACATTCGCTTGATTTTGAGTAGAACATTCG
CTTGATTTGAGACC