Description :
From Genome Similarity Track
Location :
Scaffold_283:7268- 8870
Transcript NameFunction/comments
Albla_Nc14113720ATPbinding Cassette (ABC) Superfamily putative

Sequence
1602 bases(100 bases per row)
AGCGCATAGACAGCGAGAATGACCATATTGTTTCCCACGTTAACGTCCGACATTCCGTACTGCGCTAAAATATTCCAAGATACGTCCGTGTTGACCACCG
AAAAGTGACTGTACATGAATGACTCGAAAGAGTATGTGTGGAAGGCGGCATAGTATCCCCATCGCCAGTATAGAGGTATCGCGTCACGAGGGACCATAAA
GCCCTCACAAAGCATAAACATTCCAAAGACACCTGCTCCAAGCGCGATCCCAATGATATAGTGAGGTACTGCGGCTCCCAGCACATGCATGAACGATTCT
GCAGTGACCAGCGATAAGAAAAGGTTGATGAAAAAGGACTTGAACGTGTGGATGGATGCGAAATGAACGATAATAATGGATGCCAGTAATGTGATGATGA
TGATCCCGGGAATGGATGCCACGAAATTGGCAGCGACATAACTTATCAAATTGATGGAATGATTTGTTCGTTCTCGCACAAAGACAGCTCGAGCCTCAAT
GAAAGATGGAATAGCAGCGATGGACATGAATACCAAAAACGCCTGAACGTAGAAGAGCAGAGGCACAATCTGTTCTTCATTGAGCTTGCGATTGGAACTC
AGGTACATCGTTCCGATCATCAAACAGAGCAATAAATACATCAGCACCCGAATCCATACAACCGCGGGGTTTCGGACCGTATTGATATAATTGCGGTAAC
ACAAGACCCGAAATTGTAAGTACGGCGAAGGATGCCAAGCTCGTACAAGATCCGGATCGATCCCATACGCACCATGCTCTCGATCGTGGATAATTGTTGA
ATGTAGTCGTAGTGCGTCGTTGCTTGTCCGCCACTTGTCGACGAATGGCTCAATATGTAAATCATCCACGAAATCTTTGTTGACCAGTTGAACGAAATAT
TCCGCAGGATTCGAATAGGTCGGGCATTGATACCCAATGGATGTAAAGTGGTTGATCGCATTGGTACCGGAGCCAAAGTAAACCATTTCGCCAGAGCTGA
GAATCATGAGATTGGTCAAGAACTCGTAGATCGAAGACGAAGGCTGGTGGATAGTGACCACAACTGTCTTTCCATCTTTGCAGAGGTTGGACAAGTGCTG
AACAACGTTGAAAGCCGAGGAAGAATCCAAGCCTGAGGTCGGTTCATCCAGTAAAAGAATGGACGGATTCGAGAGTAATTCCACTGCGATACTAAGACGT
TTTCTCTGACCATTAGAAATCCCTTTGTGAAAGAGATCACCGACTTGTGTTCCAGAGCAGTTTCGGAGTCCCATACTATCGATGACTTCCTGGACACGTA
TCTCCCGCGCGAGTTTTGGAATATGTGTTGGTAAACTCAATGCGGCAGCAATACGCAGTGTTTCAAGAACAGTAAAGGACCCATAAAACGACATGTTTGG
AGACACATAACTGGTGACAATTCGATACGACTTCTCCTCTCGAGCTTGTCCATTTACTTCAATGACGCCCTCAATATGTCCAGTACTCGGGTCAATACGA
TTTGCCAACAGATCCAAAAGCGTAGTCTTTCCAGCACCAGAGGGACCAATAATGGCAGTCAGCTCTCCTGGTGCGGAACGACCTGTGATCCCTCGCAGGA
TG