Description :
From Genome Similarity Track
Location :
Scaffold_66:72678- 74368
Transcript NameFunction/comments
Phypl_g2275myosin-like protein

Sequence
1690 bases(100 bases per row)
CTCCATGGACCTGGACAATGTGGCGGAGATGGACAATCTGCACgaggcgccgctgctcgatctACTGCGGCGTCGCTACCTGGAGGACAAGATCTACACG
TACACGGGCGATATCCTCATCTCCATCAACCCGTACAAGAACATCCCCATGCTCTACAACTTCCCGGAGCTCGACTCCATTGGCAAGCTGGACAACCCTG
TGCCGCACGTCTACTCGACGGCCCACGGAGCTTACCACGCCATGAGGAATAGCGGCAAGTGCCAGTCCATCCTCGTGTCTGGAGAGAGTGGAGCCGGCAA
AACGGAGGCCTCCAAGTACATCATGCGGGTGCGTCAATGACGCACAACTGGGCGGTAATTCGTTGCTAGTTGGTGCTAATCGGTTGATGTTTTTATTTTC
TCAGTATCTCGCGAATATTTCGGAGatcggcaagaagaagcccaaggtTCCGAAGGCGGAGAACGACGGATCTTCCGTGGAGCAGTGTGTGCTGCAGAGC
AACCCGCTATTGGAAGCTTTCGGTAACGCCAAGACCATCCGCAACGACAACAGTAGTCGCTTCGGCAAGTTTATCAAGATTTTCTACCATGCGGACGGCA
CCATCTCGGGTGCTACGACGAGTCACttcttgctggagaagaGTCGTATTgtcggcagcgccgaggcggagcgcAACTATCATATTTTTTATCAGCTGTG
TGCGGGACTGCCCACGGAAGAGAAGAacacgctcaagctgaagcCTGCAAGTGACTTTTGCTTCCTCAACCAAGGTAACTGCATTCAGGTGCCAGAAATC
AACGATAAGAAGGACTTCAAGGAGCTAGTTGAAGCTATGGGCACAGTGGGCATCCTGCCGGAGTTGCAGCATACCATTTTCCGCCTCGTTGCCTGTGTGC
TGCATTTGGGTAACGTCGAGTTTACGGAGAATGCGAAGAACGAGTCCCAAATCGCACATCCGGAAGATGTCACGAATCTGGCTGAGCTGATGATGGTGAC
CCCGGATGAGCTCGAGTTTGCGCTCACAAAGCGTACGATGTCCGCTGGTGCACGTGGGTCGGTGGCAGAAATCGCGCTGACTGCTGTCGAGTCAATCAAG
TCGCGAAATGGTCTGGCGAAAGATATCTTCAGCAAGATCTTCGACTGGCTGGTGTTCCAAATCAACAAGTCGACGTCCAACGTCGGCGGAGTTTCTGGCG
TGGGCGCGGGGTCCAAGTTCATTGGAATCCTAGATATCTTCGGTTTCGAAAGTCTGCAAGTGAACTCGTTCGAGCAGCTGTGTATCAACTACACAAACGA
aatgctccagcagcaattCAACCAGCACGTGTTCGTGTATGAGCAGGAGGTGTACGTTGAGGAAGGCATCGACTTTTCTCGCCTGGAGTTCAAGGACAAC
GGGCCGTGCCTAGACCTGATTGATAAGAAGCCTCTGGGTATTTTACCTCTCCTGGATGAACAAGGAATGCTCGGTCGGCGTGCGAGTGACGAAAACTtca
tccagaagctgcaccagaCGCATCTGGCAAAGGGCAAGGTTCCTGAGGGTACAACTATCTACTACTCGAAGCCTCGATTCGCCACGGATGAGTTTGTGAT
TCACCACTACGCTGGTGAGGTCACGTACAACGTCAATGGTTTCTTGGAAAAGAACGATGATTCGCTACACAACGATTTGATCTCTCTGAT