Description :
From Genome Similarity Track
Location :
scaffold_547:7267- 9347
Transcript NameFunction/comments
Pl_103924myosin-like protein

Sequence
2080 bases(100 bases per row)
GATGTGGACGACCTCACGCAACTCATCGAACTGGACGAGACGACGATCCTGTCGGCGCTTGAGACGCGCTTCGCTCAACAGAAGATCTACACCAATACTG
GAGCTATTCTGCTAGCTGTGAACCCGTTCCAGAAGATCCCAAATGTCTACAGTAAAGACACAATGGCCAACTACCTGCTGTCGTTCGAAGCTAGAAGCTC
CTCGATGCGGAATAAGGGAAACGAACCCATGCCCCCACACATCTACCAAGTGGCTGGAGAAGCGTACAAGGCCATGATGTTAGGACTGAATGGAGTGATG
AGTGACCAAAGTATTCTCGTGAGTGGAGAAAGTGGAAGTGGCAAGACAGAAAGCACCAAGTTCCTCATGGAGTATCTCGCACAAGCCGGAGCGAATAATC
TTGCGGCATCTGTCGCGGGTAAAAGTCCTGAAGGCATTGCAGCTAAGGTTCTCCAGACGAATATTTTGTTAGAGTCTTTCGGTAACGCACGCACTCTACG
CAACGACAATTCGAGTCGATTCGGCAAGTTTATCAAGCTGCACTTCACCAGTGGAGGCAAACTCACAGGTGCCAGTATCCAGACATATTTACTCGAGAAG
GTACGACTGGTATCGCAGTCCAAGGGTGAGAGAAATTATCACATCTTTTACGAAATGTCGATCGGCGCAGCTCCCGCAGCTCGCAAACGCTGGTTCCTAG
ACCCACCAAAGGGCCACATGATGCCTCCTGGTGATCACGGTGAGGTTACGGATGCTACACGACAGTTCCTACATTATCGATATTTGAACCAGAGTGAGTG
CTACCAGCGTCGTGATGGTGTGAAGGACTCGGACATGTTTCGACGAGTCATGGACGCCATGGACATTGTGGGCTTCACTCAGGCGGAGCGTGCGGGTATT
TTCGATATCTTGGCTGCACTCATGCACATTGGTAATTTGTCTTTCGAGCACGATGAAAACAGTGACAAGTTAGGTCAGTCAATGGGACCTGGTGCTGGCA
AGTCTGATTTGGCACCGAGCTGTATTTGGTCTCGTGATGCGGCTGCTACGCTAATGGCTGTGGACGCGACCAAGCTGGAGCGAGCGCTGAGTGTGCGCAG
AATTCGTGCTGGTACTGATTTTGTGAGCATGAAGCTTTCGGCAGCACAAGCCAACAATGCACGCGACGCACTGGCGAAGGCGCTGTACGGCCGTCTATTT
GACTGGATGGTGAAGAAAATCAACCACTTCCTCAAGATGGACGACAGCCAAAAGGCGAAGGGCGGTCTTCACTTTATCGGTATTCTCGACATCTTTGGTT
TCGAGGTGTTCCCCAAGAACTCCTTCGAGCAGCTATGTATCAATTTTGCCAACGAGACGCTGCAGCAACAGTTTAATGACTACGTGTTCAAAGCAGAGCA
GCGTGAGTATGAATCACAGGGCGTCGACTGGAAGTACATTGAGTTCTGCGATAACCAGGACTGTGTCAACTTGATTTCGCAGCGACCAACTGGTATCCTG
TCACTTATTGATGAGGAGTGTGTCATGCCAAAGGGAAGTGACACGACATTAGCATCCAAGCTCTACCGCGCGTGCGGCAGCCACTCACGATTTGAAGCTT
CTCGTATTCAGCGAGCACGTGGTCTCTTTACGATTGTACATTATGCAGGTCACGTAGAATATTCTTCAGATGGGTTTCTGGAGAAGAACAAGGATGTTCT
TCACCAAGAGGCGGTGGATATGCTTGTGTATTCCACGCGGGAAGACAGCTTTACGCGTATTTTGTGTGAGGGCTTTGGTGGCTCGCGTGACCGTGCCAAA
TCTTCTCCACGTCAACGCGCACAAACAAGCAAACACCGAGGCGCAAGTGTTGGTCTACAGTTCAAGGAACAGTTGACAACTTTGTTGGAGACACTACACC
AGACAAACCCACACTACGTGCGATGCCTCAAGCCAAATGATTTATGCAAGGCAGGTATTTTCGAGCGTGACCGTGTATTGAACCAGCTGCGTTGCAACGG
TGTCATGGAGGCTGTTCGTGTGGCGAGAGCAGGGTACCCGATTCGTTTGCCGCTTAATGAGTTTGTTGCACGTTACTTCA