Description :
From Genome Similarity Track
Location :
Scaffold_42:7266- 10228
Sequence
2962 bases(100 bases per row)
TTAGCCTTAACTCAGACACGTAACTCTTACTACCAGAGACGTCTTTAAAAGACACGTGTCTAAAACTAATCAAAAGGGGAACTGAATATATTTACTGATT
TATAGCGATAATAAACTTTACTCACGTCTTTAACCTTAAACCTATGCTACCTAATCGAATAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACT
ACGTCACCTCTATGAAGACCCTATTACAATCAATATCCTCGAACCATAACCGATAGGGTACAGTTTTATCGCTTAGCGTATGTGATACAAAAGTACGCCT
TATCGGTGATACTGATCTCTTTCTGTGTATACCACACCAATGTACCTGGTTATCACAACCATTTGTGTAACCCCGTTACACCCTCCTCCACCAAACAGTC
GATACCCCGAATCGACATTCTTCACCTTTCTCATCGAGATAGCTCGAAGAGAACAGATAACATTACGGTTGTGTTTACGACACCTTACGCACCAATGATG
AAGTCTTTGCATTCCTCCGAGTCTTTGGAAGACATCATACGAGAAGAGAACATCGTTGATTATGACAGTGACACTGTCGTCGAAGAGGATGAAATACCCG
AACTTGCCACGTCAGCGTCGTGCAAACCTTCTCGCATAGCGCCAAACCCATTTCCGGAACGAAGCACGGCTCAAGCGCTAACAGCGTTTTGTGCCTCAAC
TACTCTTGATGAACCTATCATCACCAACAAGCTCGATGAGCAACAGCAACGCTATATCGAGGAAAATGAGAGAGCTAGACATCTATCTCAGACATTAGCT
ATTGCCGAAGAGCATTCGGACTATCGCTTCAAGCCTTTGAGCGTTAATGAGTTGTTGCGAAAGTTCGCAGGGCAGCCCTTGACTACTTGTCCCACAGGGC
GCGAGGCTACGACGTCTGACGACATTGCCGAACGAGGTGCTCTCAGAGAGAGATACTTGACGCCCGAAGCGACGACGATCTCCGAATACCAAATCAAGTT
AACGGAACAAGCACGTGGTGCCTCTGTACAGACGCAGAGAACGGTCTCGGTTGTTCTGTACCCAGGTGAGAGTGAGGCCGAGGATCACAGCACGTTCACT
CGTTGGGCACATAGGGCGCATAGGGCACGTTGGTTGCCCAGCATGAGTGACCTTCGATCTAGTGCCTCCAAGGCCGACGTTCGGCTAGAGCGCAAGACGC
GCTATGAGTTTGCTAAGGTTTAGGCCAAAGTCCAGCTACGTTCACTGAATCACACGCAGTACGCAAAACCAGTTGCTGATCCAACCACCACTGTTTCGAC
TGTGTAGACAGTCGCGGGTCACTCGGTGTTGGTGAGCGATCCCTACACCCCCACACCTATTGGTGGAAGCGCTTGGGGTGCAAGCTGACCCGCAGCGCGA
CGCTCAAAAACGTCAACGGCGTACGGGTAATCTTTCCGAAGGGGTACCTCAAACTTCCATGAGTTTTCAGACTCAGGGTATCCACGCCACTTCACCAGAT
AATGGTATTGACCTTTGTGAGGACGCCGCTTCAGAAGTCTCTCCACATGGAACTGTAAGTTCCCTTGCTCGTCGAGCAACGCAGGAGGGGGTCGATGTGT
CGACACAGGCTCATAAAGACTTGGTGTCAGAGTTGAAGCGACTCCGAGAGTCTTTTGCTCACGTGCTGACAGCACTGGATCAGTCTGTGACTGAGAGGAA
GCAACTTCAGGAGAACCTTGACCAAGTACAACACGCTCATGAACAGTCACTGACTGAGTTGTCTCAGTTGCGTGAGCAGGTTTACCTTCTCTGCTCGATC
GACTTGGTCGACAAGCGACTGCGGAAGGCGGAGTACAACCTGCCACGGCTGGATAGCCAGTGGAGCGCTTGACGAAGATGCAGCTAGCGGGGACGACATC
CCACCCTCAGGCGCAAGCGCCTTCCCGTCCACGAGAGAAGGATCGTGGTATGGCTTAAGCAAGCCAACGTAAATCACTGGGTGTGTGCGCAACTTGCGCA
GAAGATTGAGTGTATAGACAAGGCCTTTCTTCGCTATGACCGTAAACGGCCCAATGAAGCGCGGACGCAATTTCGTCTTGAAGATGGTAGACACTACATT
TGTAGGTAGGTTTTTAGCATTTAATAAGACTTGGTCTCCAACATCATAGAATCAATACATTCTCTGACGTTAGCATCAGATTTTTCTTTTTGGTTGTCTT
GGCTATCAGCAATTGCATCACACACATGTTGTGAGACACTAAAACGCGGTGCGAGAAAAACTCGCTCACTTGTTTCTGCATCGTGTTAGGGCTGATTTCA
GCAATCTTTTCATCAGACTCTCCCCCACCAAGCCCAGAACCACGTAGTGGTATCGTGAGCAGAACGCTGGGGTTCGTGAGGCTATTCACATATAAGGGAG
TAAAGCCGGTCGAGGCATAAACAGCGTTATTCAACGCAAACTCAATGACGAGGAGCATCGATTTCCAAGTCTTAGGCGACTCAGCACAAACACTGCGAAG
AACGTCGCCAATGATGCGGTTGACTCGCTCAGTCTGACCATCGGTCTGCGGATGATCCACTGTGGACATTTCTAATCTCGTGCCGAGCACCTTGAAGATG
TAATTCCAAAACTTGCCTGTGAGGCGAGGGTCGCGATCAGAGATGATTGTTAGCGGCAACCCGTGTTGACGAAACACACGATCAATAAACAGCATAGCTG
TACCTTTGCCATCGATGGAATCCGGCACCGTCGCCAAGTGAGCCATCTTTCTTAAACGGTCAACAGAGACCACAATTCCCTTATTGCCGTCACAGTCTTT
GGGAAGACCAAACACAAAATTCATACTGATGGACTCCCAACACCCCGTGGGCACAGATAAAATGGCGAGTGGCGCAGCCGAATGTGCTGAGGGTTTGATC
CGCTGGCACGTTTCGTATGTACGCACGTATGTGCTCACCCATTTGTAGAGTTTGGGCCACCA