Description :
From Genome Similarity Track
Location :
Scaffold_84:7265- 11365
Transcript NameFunction/comments
Phyke_g3671hypothetical protein PHYSODRAFT_491965
Phyke_g3672serine protease family S28, putative
Phyke_g3673hypothetical protein PHYSODRAFT_329926

Sequence
4100 bases(100 bases per row)
tcgaagcaCACAAACGCGATGTTCACGGCCCAGCGCGGATTCAATCGAATCAAGTCACGTACAGCACCCAGCGCAATTTCCGTTGCTCTGGGCACAGGAA
AACGTAATAGCCCCGTCGAGAtcgaagcaacagcagcccaCTCAACGTGATTAGTATCGGCTGCACGCAATGCGTTAACGTACGTTTCATACAGAAGCGC
TTCGGAGCCCTGTTGATTGCCTGAGGCCCCCACACAATGCACCAGTAGCCGTGCGCCAGAGTCACAGCCTACAGTGCACAATACACTCCCCGCTTTTGCA
CTGGTTCGCAGCCCAACATTCTCCACTGCACGATCCAGAGCTGGACCTGCACGGCCATGTACGCTACCAGCGACACCTGTATGTGGGTTTCTGTAGTTAG
CCGACGTTGGGAACACCAGACAATCAACACGAAGGTCCCCGACACTCTCGATGTCCCCCAAGTCTCCCTTCACCACCTCGACGTGTCTCTCAAAGCACTC
AAGTTGGTTGCGTAGATTCAGATAGTCCTGGAAATCACTACAACCGTTATCCAGCAAGACACTGCGGTGCACATCGACGGTAGCAACGTTTTTGACGTGG
CAAtgcgcctgcagcagctcacgcCACCAGGCATCATCGTACAGGATGCAGTAAGTCAAACGGTTAAATGCCATGGCCTTGCAAAGCATCGCAACACTCT
CAGCATCTATGAACAGTAAAAAGTCTTGGAAAAGTTCCTTGTTCAACAGCAGTGACGCGCACAAATTCGTGTCCCTCGGATCTGAAGCAGCTTTAAACCT
CCCTGTTCTGGCAGATCGACGTCGATGTCCTTGTGTTTTGTGGTGTGAGCGCTTCGTACCGACCATCTCTTTATTCTGCTAGTGTTAGACTGAACTATTA
AGCTGTAAAACTAATGACTGGTTCAACTagaacatgttgaagtgacgaTAGGCATACCGATGGTCTTCGATTAACTCCGTCTaattttcatccaatcata
ACACCCCTATATATCTGTATTAACCAATCATATACTTCTGATATCGCATCCTGGCGGAACAGACACATCAAATTTATCTCGTATCatgccgccgccgccg
ccgccgccgctgctgctgctgctcgtgacGCTCGTAGCTTGTGTACAGGCCTCTACATTCCCCTCCCATGCAAAAGATGGACTGCTGTGGCAAATGATAC
AAGCGGAGGATAATCTGTTGGTCCAGGTGGACGCCCAACAGCACTGGTTCACGCAACAAGTGGACCACGTCGCGtccgacagcaacgacactTTCCAGCA
GCGTTATTACGAGCAGAACGAGTTCTGGACGGCGCCCACTGGCCCTGTGATACTTTATATCGGAGGAGAAGGGGCAATGGAGAAACCCCCAGGAGGATTC
GTCAGCGTCATCGCTCAGAAATTCGGTGCAAAGGTCAGGAGATGACAATGATACCATAGTAAAAGTGTAGTATTTTTCACAGTattgctgcttcttttgT
GCTTTTTCTGTGATTGTTCAAGTGCAGATTCTAGCTCTGGAGCACCGATTTTATGGCAAATCTGTGCCCAATGGAGATCTGTCGACAGAGAACTATCGTT
ACCTGACTGTACAACAAGCTCTCGCTGATTTGAAGCACTTCAAGGAGAGCTACCAGGAGAAACTGGGCACTGAGGATGGAAACAAATGGATTGCTATTGG
AGGGTCCTATCCTGGTGCACTATCAGCGTGGTTCCGCGTTGCGTATCCAGATACGACAGTGGCATCGCTGTCATCCTCAGGAGTGGTGCAGCCAATGTAC
AAGTTCCACGAGTTTGATGAACAGGTGGCACTGGCTGCCGGGCCTCCGTGCGCAGGAGTTCTACGCATGACAACCACAGCTTTTGAAAAGCAAATTATTG
GTGGGAATGCTACGAAGGTGAAGAGTCTGTTTGGTGCTGAGGGTTTGGCCGATGCTGATTTCTTCTACATGATTGCGGACGCTGCCGCCATGGCTGTACA
GTACGGTCACAAGGACGTTGTGTGCGACCACATGGTCAGCGCTTTCGAGCGCAACGATTCACTGATCGAATCCTTCGCCAACTTCACAATTGATATGTAC
GGCTCTTCGTTCGGCAGTGAGTGCTTCTACGATACAAAGTGCCTGGAGCAAGACAGTGCACGTTGGGGCGACGGGCGCTCATGGCGCTGGCAAAAGTGCT
CTCAGCTTGCGTACTTCCAGGTCGCTCCTGAAGAAAAGAGTCTGCGCGCGGCAATTGTAGATCTGGACTATCACGAAAAACAGTGTCGCACTGTCTTCGG
AGACGTAGTGCATCCGGCTAAGGGCGTGGAGGAGATCACGGAATTGTACGGAGGAGACCACCCCACGGGTCACAATATTTTCTTCTCGAATGGTGGGGAT
GACCCATGGCAACGTGCATCAGTACTCCATACGCTCTCAGACGATCAGATCGCTAACTTGGCCAAATGCGATCTGTGCGGCCACTGCGGTGACCTGCGTG
CGGACCCTAACGTCCCTGAACCGCTTAAGAAGCAGCGCGAGGAGATTCTCAAATATCTGGCGAAATGGATGGGTGCATCGGACGAGGCGAAGCTTGTGGA
GAACATGATACATGAGGCGGCAGCTCTACCTCACACAATGGATAATGATGACCAAGAGTATGCAGGAATGCAGCTAGCAGGATTGCACCGTTCGTCGCCG
TTGGTGCTTGTGCCCATTGTGGTTGCGTTCCTGGCGCTGGTTGGAATTCTGCATGCCGACGTTGTTCGCGATGCGCCTGCGCAATTAAGGTACCAGCTTG
CCCACACGCACGAGTTTTGAAAATTCTAGTCGATAAAAACACAACAGGGACAAGCCTACATACAACTGCGCTGTACGACTTGACCATGTTGTAAGGCCAT
ACTGCGCTGCATCTTAATTTTTTCGTGGATAAACGATCAAGGTCATTCTAAGTTTCAGTGAGTCTATTAGCATACGCATGCATATATTCAGCAGCCCTCG
CTAGCATAGTGATCAAAAGCGATTAAGATAGATTTAAGAGGTCTGCGCCTGGGCCTTAGCGTTAAGCTTTGCTGGTGCAGGGGCAGTACCCATCGTCTCC
TTTGTTGAAATATAGGCGTACGTGGCCCCAccgatggagacgacgacgataccGATAGCCTTCTGCACAGTGATCACGtcgttgttgatgaggaTGGACA
TAACGATCACGACCACTTGCTTCATGTTGCCGCACACACACAGTGTCACAGGCGACGTGACTTTGTTGGCCATGAAACTCGTGACATTCAGCATGAAACT
GATGATACCCGTCAGAATGAACCAGAAGCTTGCCGACGGCACCACCTCCCAGTTATCCATGATGGTGTCGACTTCACCGGTCAAAAACATGGTGACCAGA
CACCAACAGGCCGACAGCGGCGCCTGGTGGAGGATCAAGTCCACAGGGTGCAGCTTCAGATCTCCGCTCAGGAACTGCAGTTAAAACACAGCAAAGTAAC
AAATTAGTCAATGCTTCCGGAAGTCCTGATGTCAAATAGGTAGATTTGCTGTACCTTGTTGGAGAGCACAGCCTTCAAGCCTGCGAAAATGATGGCCACG
ACCGTGATGACGAAGCCCAATACTGTGCACGAGTTGTCTCCAGTGCACGCAAGATAGACACCAAACGCCACGGGGACAAGCGACAATTTGCGCTTGAGCG
AGTACGTCTTGCCTAGGATCAGCATACTCAGCACCACAACAACCGCCGGCACAAGCGCTCGCATGACCTGgttgaaggagatggaaaCCAGCCCCAAACT
CCAATTGCCTGTGATGATGTTGCTCACAAAGATGAAGGAAAAGTAAaccatgagcttcttctgtCCAGGTTTGAGCGGTTTCCGTTCGATGCCTTTGTAC
ACGTTGATGTAGAAGAAGGCACCCAGTGTATTGCACACCATGTGCACGAATGTGAGCGTCACAGGCAGTCGCAATGCCCCCAAcgccttcttgttccaga
AAGTGACGCCAATGTTCTGTGTGAACCACATACTGAGCCAGAAGACCACGACGGACGGCGCCACGTACGACGTCTTGGACATCTTATTGTTCGCagcctt