Description :
From Genome Similarity Track
Location :
scaffold_949:7263- 8466
Transcript NameFunction/comments
g10681.t1 hypothetical protein PHYSODRAFT_504509

Sequence
1203 bases(100 bases per row)
AGGACGGCCGTCTTGATGACTCCAGACTGGAGTCTAAACTCTGCACCACGAAAGAGGTTTTAACCTCGTTTCAACGAAACCCCTCACACCTGTATAACCG
CCGGTTATTAACCGATACTGGTTGGAACCGGTCGAATCCAGTGGGAATTTTTACGGTATGGTAGAATAGGACAGTGTTTGTCGGAAACATGCAAGGCTGA
CACGCCGTATGACGCTTGCCCGTGGTCAGGCAAGATTCTCACCTGCCAAGAGCTAAATTGGGTAACTGTCATGGAGCACGGAGCTCATGAAATGCTCGTC
CAAGATCCACGCAAGCCCCAGCTCACCCCTCGGCTGAAGGACTACGGTCGCGAAATAACGACCCAAGGGTTAAAGCCAGCTCAAATCCGCATGGGTATGA
GTCGACGTTTCGGATTAACGGAGGATGGAATGCCGACTTTACGCCAGGTGCAGTGGTTCGTCGGTAACTTTATGAAAAAGAAGTTGCGCCGCACGGACGA
CCATGACGCCATGCTGGATCAAATTGGCCAGTTGGAGTTTGGCTCCTCCACATCGGATACGCAGCCATTTTCGTTCGGCTGGAGTGAGGGGAAACCAGAT
ATGGGTGACGGCTCTGACGGGAACCCTTTCCTAGTCGGTTTGACGACCAAGTGTCTGCTACACAACGTTGCGCGGGACCCGACATCGTTCGTATTTCACA
TGGATGGAATCAAGTTGAACCAGGTGGGATATCCTGTCATTGTGTGCGGCATCTCGAATCGCGGATGATCTTTCCACCTTGTGACTCTCTTCATCACGTC
ACAGCGGCTGGAAAGCCTTTACGTGAAGGCGCTTTCGACTCCTCGCAAGATATTCACTGTGGTTGGTTACCAGTCAGCAACTGTCCCTGAAATACGTGAT
GGTTGATGCTGAAGCTGGTCAACTTAATGCCCGTTACCCAAGTGTTCGACATGGGCTCTGACCTGACCTACTTGATGTGCTTCTACCACATAATAGCCAA
GGTACATGAGAGACTCAAGGGGGTACCAGTTGCACTGCGCGAGCAGGTGGTCGCTGACATTTACTACCTTCATTTCGCGTCAAGCCAAATTGTCTATGAC
GAACTGGTGCTAACAGTATTCACCAAGTCGTCGGGCGAAGATCAGTTGTTGGCGTTTCGGAGCTACTTCGAGGCGAATTGGGTGGCAAGTTCGTTCAACC
GCT