Description :
From Genome Similarity Track
Location :
Scaffold_23:72616- 73632
Transcript NameFunction/comments
Phymu_g1513hypothetical protein PHYSODRAFT_490853

Sequence
1016 bases(100 bases per row)
TTGGTGACCAACACTCCGCGTGGGCGACCCGCTGTGGACGTCATCGCCACCTACATGAACACATGCGACCAGCGCACGGTGAAATCGGAGCTGATGCGCG
CCCACGCCCACTTTGCGTCTCCTCGAGGTACGGAACAGCCGCCGTGAACTTGAATTCTGCTGCCTGCTGTGCTTGAAGTTGACGTAGGAACTGACTGGTG
TGATTTGGTGTCTTGTCTTGTCGTTGGGACGTTTGTGTTGCGTTGTTGCTTTCGTGGTGAAGGTGGCCCGCCGTCGCGCATCCGCTCGTCTTCCATTATG
AGCAAGGAGGGCAGCGCCGAGTGGGGCTGGTTCGCAGATATTgactcgagcagcgagagcTGGGGCGGCGACGGTTCCGTGCACTCTCTGCGGCGCCGGC
TCAGTGCTGATCTGGGGCTTATAGACGTGGGCAACGTCCACGTCTTGGGCGATGAACAGACAAACACACGCATCACAGCAGCTCACAAGACGTTTACGAT
CGTCACAGAAGGCAATAGCAAGGTGGTCTCCGCTACGGTGTCCATCCCCAAGTTCCGCATTGTGCAGTCGCGCTCTGGCGCTGATCGCCACGCGCAGTAT
TTAATCACCCTCATGCTCGGCAAGGAGCTGTATGCAGACTGGCGTCGGTACTCGGAATTTGGGGAGCTCGTCAAGACGCTTGATGAACAGCGTTACAAGC
GGACACAAGACGCATGGGCACGGATCGAAACGCGCTGGTTCAACCGGTTAGAGCCGTCGTATCTGCATCAGAAGTGCATCACGCTGGAAAACTTCATGCG
TGAGCTCATGTATGAATCGAACGAGCCGACTGTGCTGATCAACTTCCTCGGTGGCTATATGGGCAAGGTAAACGCACGGCCTACGGACCCCGTGGCTTAC
CGCCCTGCTGCACAACTGCCAAAGGAGCTTCGTCCACCGCAGCCGCGTCATGAGCGAGAACTGTTTGAGAAGATGTGGGCCGAGAACTTTAAACGGTCAC
ACGTGGACTACTCAGG