Description :
From Genome Similarity Track
Location :
Scaffold_105:72607- 80622
Sequence
8015 bases(100 bases per row)
ACGAGAGAGGCTGGTTGCGTGAAAGACTTTCGCTACTAGAAGTTTCGCCTTCCAAAATGTTTGACGTTGGTATAGCAACAGTGCCGGAGTCTGTGTCGAA
GACGAGACCCAGCACCTTGAGCCTGGAGCTCCTTGACGTGAACTTGTCGTCGTTAACCGCGGTAGGGCCCATCACAACAGTCATAGCGTGGCGCAGTGAA
CCTTCAATGTCATCGCAGCTCGTTCCGGAGTCGGGTGCGACGTTTACGTGATCATCGACCCAGTGGTAGTTATAAAACCTGGTGGGGTATGCGGCATTTG
TGCACGATCCGTGTATGAATGCCACCGCACCGCCCAAGATGCTGTACGCTGCGGAGCTACCGGTCCACCCAAACGCGAACGAGAGGTCGATGGCGATCGC
GTTGTTATCGAGGATGTGACCCGCAAACAAGAACACGCACTTGCTGTGAGAGCACGCATTACGGTAGGCGGACGCGACGTCGCCGGCCATTAACTGGACG
GTCTTGTCTGGGGATAAACGGCGACACCGGATGATTTCCTATGAAACGCTTGAGCAGTGCTCGAATGATGCAGACGGGATGTCGTCCGCATTAGTGTGGG
AGCTGAACGAATCTCCCCCGGGAAAAGAGAGGTCGTGGATAACACTACCCGAGACGCGTAGCTCGCCGTCGTCTTTGTCGGCCATGCCGAAGGGGCAGAT
GAATAGCTCCGGCCAAATCATTTTGATGTCTGCGTCTACAACGGTATAGCGAAGGCATCCTGTTCTTTCCTTATGTCGGCTCGTAAAACATGGATGCGTT
GCGGAGCGGACGGGTGGTTGCGGGGAGCGATCGCTGTGGAGGAGGTGGGGAGGTGAGGCGCACGCGGGAACCCTCGACAGCGATTCGCAGGAGATCGTCG
ACATGATCATATCCTTGGCAATACGCCCGCAGAGTGTCAGGCGGTAGTGCTTTATTGAGCCGATAGGCTGTGGGTGACTGGCAGCGAATTTATTTAGTGA
ACTGTTTGAGGGGCATTTGTGTGCGCCGGATAAACGCAGAAATTACGTGTTGCATTAGTTTTGCGAGCATGTCGCGGCTGGGTGCCGATTCTACGGGAAT
GGCAGTGTGCCTGACGGGAAAGTGCATGTTGACTTTGCGGAATGCAGTGGAGAGGGACGCGTCGTGGAAGGATCTCGCGCGCTAGAGACCTGAGACGCGA
ATCCGTGTCAGCGTGACGGCGATGGGCGTAGAGCTTGTTTGTTCCCTTAGGTTGGGCGCTAAAAGACTGCAGCACAGGAAAGCGTGGGGGGGCGAGTACG
CGGATGAATGCCGGCCAGCCGTAATGCTGTGGCTGTCATCGGAAGGCGCGTGTGTGATTAGAGTAAGTAGGAGCTGGTCGGTGCTCGAGCCCAAATCTTC
AGTGGAATGGCAGCTCACCGGCATATGGCTGAAATGGTTGGATTGGTGCACACGCATCGACGGCAAGGTCTTTGCTGGCAGGGTTGTCAGGATTCACGTC
GGCAAGTGTGTTGGGCTCTTGAAATACGCCGTGTGGTTCACTAGAACTCAGATTGTCAGTATACGTGTGTGTATTCAGATTACGGCTGAGGCTGGGGGTA
CCGAAGCACTGGCGAACCAGCAGTACCTCGGCCGTATCAGGCTCAGCGCGGGTCGGGCGGCTGCCGTCGGCCGAACCTCTTGGTGGCAAAGCTTACCAGT
GCAGCAGGGAGCTCGTCTGGTCAGGTGTGTTTCCGGCCCGCCGCGCACGTGTCCGGGTTTTCACCGGAGCACATGCCCCCACCAAATAAACGTAGAAACG
GCTTCACGCCATCCGTCATGTGGGATGATGGCGCGCACGCTGGCTGGAATGTCACTCGGGCGAGAAGGCGGACGTGCGTCGTCACCTCGGTCCACACGGC
GGCTGCGTACATGGGGCCAAACGTCCGCGGAAGGCGCGTTTGGGCTGGGCAGAGCTGTCGCGGTATGCGTGCCGCTGGTATTGGCGATATCTTGGAGAGC
CGTGGCCCGTCTAATGGACCTGAACTTAATTCGCGTTGCTGTGGACGAAAACACCCGCCACCAGAAGGAAGTGTCGCTAGAAAGATGAACGTACACAGAC
CCATTGTGCTGGTTTACCTCGTGCAGTGTCCGTTGCGCGCGCTGCGGCGTATAATTGGGGTCCGCGTCCATGTTGGCGACGCCGAATTCGCGAATGTGGT
GCAAAGGGCGCGTGAATATCTCTTGCCACTTGGCGTGCGCAAAGATGAGCAGACTTTGCACCGCTCCGAGCAGGCCGTAGTACGTATTGCACGCTGGGGG
CGAAGGCGGTGCGACGTTAGAGCCGAAGTCAAGGGTGAGGTTGGTGTCGGACGATCCAGCTTCGAGCTGCGTTGCAGATTCGGCGCGGCAATAGTGCATG
ATGAACGCTCGGCGTCGGCCAACGCGAAGCCCCGCGGTAGCTACGATAATCGTTGAGTGGTCGTCGAAGTGCACGCATTCTAACATGCGCATGCATAAGA
CAAACGAAGTAGGCGTCTCGTGCTCACCAGCCGGTGTCTGCCAGTAAGCGTATGCCCTGTGAGAGGCAAGGCTATGGACGGCTAAAGGTACGAAGACTCC
TCTAGTGCGCAGCGCCGAGGGTGGGAACTGGGCCACGTGCAGACCGCGCACGGCTTCGGGTGGTAGCAGACCGCGAAGGTTGACTGATGTCCAAGAGGAA
GGTATCTGTACGGCTCCCACGTCCGTGGTGGCGGTGGTGAGGGATAGAGGCTCAGGCACCGTTCTTCCTGGACGGGCTTGAAGGAACTGCAAAAATGCCG
AGAACAATGAGGCTGGATCGTGTGTTAAGTTCGGGAATTTACTTGGGACGGGGGCTGTGCCGGACTGGGGATCTGCTGGGCGGTTGCTTTGCTGGACAAC
CGGAGACTCGACCGGCCGCACGGAGAGGGAGGGGGCGCTAGGCGTGGCCTGGTTGGAACTGGCGTTGAAAGTGCTGAAAAGAATTGGCGAGGTCAGATGG
CTCAGAGAGAGAGAGACCGCTAGTTCAGTGCCGAAGGTCGTATGGCGGGCGGCTGCGGGGCCACCGTCGCTCCCGATGTGTCACGGAGAGTGGGCGGCGA
TGGGCGATTGTGCAAGGCCTGACTAGGCGGCGGGCCGCTATCCGGCGCCGACGTGTCCATGATGGAAGGGTCCCAGGCGACGTAAGGTGCGCAAGCATGA
GTGAATTCGCTGGATGACTCCGGGTGAAGCCCGGTGGCGGTGGTCTGGCGGTCGCTGGTCGCTGTGGCTCTTGGTGTCAAACGTATAGGTACTGGGGGCG
ACACCGCAGCATGTCGGTAGGGTACGAGCCGGCGGGTAGGTGTGAGCCGATCAGGCTGGGAGGGCGCTGGAGGCGTGGTCATCACCGCAGGCTGGGAACG
GATCCGAACGGAACTGAACGTCGGCGCTGACGGGGTGGCGAGTGCCACGGCGGATGCTCGCGCTGCCTATGCTGTGGCCTCCTCCTTGTCGACTGCGAGA
CTCTTCTTCTGGCCCCGCGGCACAGCGTTAGTCGCCGCACTCTTCTTTCTCTTTGCGATGCGCATACTCGCACGGACGCGCGCGTCCGGTGAGCCGGCTG
CTGGCGTGAGCGAGGCCGTTGCGGGAGCTGTCGATGGCGGGCCTGGCACCGGGGTCGTGGATGGATGAGCCGAGGATGGCGGGGAGACCTAGACCATAGA
CATCGCTGAAGCCCGAAGCAGCGCGGTGGGCGGAGCAGTCGGAGCGGTTACTGGCGGCCCGGCCTGGAAATAAGGCGTTTACATGGAGGTGGGGGGGCTG
GACGGCGCTCGCGGGGGACAGAGGCGACAGCATCGGCACGGGCAGAGAGGTAATTATCTTGAAAGCTTGAGCTGGGAAGCGGAGACGCGAGCTGCAGTCG
TGCTGCTCTTGCTGCAACTGGAGCCGTTGTGTCTGGTCGCTATCTATTCCGAAACCTATGTTTCAAAATCTTAAAATTGAGGCAGCAGTTGGGACGACGG
TGCATTCGGTTAGCCTGTCCTCACGGGATAATGCAATGCTAGCAGAAAAAAAACCAAACAGGAGCCCAAATTGAACAAAGAATTGCCGGAGTTATCGGCA
TGTTGTCAGATGTTGCTGCTCGTAATAAGGAAATAGCGGAGGAATACATTGCTGCGTATCAACAAGTAGCTACTAGCGAAGAAGGTCAAACAGGCTAAAA
TGATGAAGAAAATACCCACACGAGACTATTCGGCAACGTTCAGGTGCAGACGCGCAAGTCTCTGGAGAACACGCATAAGCGGTAGTTGGAGCGACGTCAG
GATCAGCAGTCAACGACATAGGCGGTTGGCTGATTAAAAAGTTCTTTTGGGATGATAGTGGGAGTTAAAAAGTATTGGTGAAAAAAATCGAGCATGCAAT
TGCAAATTGACTACCAGGTCGGCCACACCATCACCTTTAGTACGGTACCGGTCCCGAATACATGTGCTTTGTTAGTATTATTTGGGCCTTAAAATGGACA
ATTTTTTTCTATTTTTGGGCTCCATCGTGGAAGTCGCAAGTCACTGGCTGCTCTTGAGTTTGTGGTTTACGCGCTGTAACACAAAGCTAAGCAACTTCAC
TTTGCTGCTCCACATCCTGCTTAGGTTCCAGCAGGTTCGGGCTGAAGCTGCTTACCATCGCTAAGAACGTGTTGGGGTCTGGCGCATCGTGAAGCTCAAA
TCTCTTGCACACACTGGATTCGGGGCCAACTACCACAAATACTCGCTTCACATCCTTCAGTAATTTGTGTTTATCCAACATATCTATCAGCCCAGCTAAC
CTTATTTCATTGATGTTTTTTTTCTCGCTACTAATCGTCCACTGAATGTAATTCAAAACTGTCTCTGGCATTTCGCTTCCACATGTAAGCGCTTCACACG
TGGTCACTGCGTCAGTGAAAGAGAAAAACGGGTATTTGGGATGCCAGTAAGTGTTCTTCCTAAGTGTGGTCAAGTAGTCTAGGCATGCTTTCTTGCAGAG
CTGTGGAAATATAGACTGTTTATTTATTGTTCTCCACGATGCATCACAATTAAGAATTGCAATTTACAATCTCAAGTGGGATTATTGTCAATAGATTGGT
GCACCCATTACATTACGTCACTGTCATCTACGTGGTTGCTCTACTCTGTATTCATGGCGTTTTCAATTGCAGCTGATACGGACCCGAGTGTAGCCAGGTC
CCGGTCTAGCTTTAGAAACATTACCGTTTCCAAAGTTGACGTACTCATATTTTTCCGTAGGTAACCTATGGAGCTTTTGACCATCGAGAAAATCGCTCCG
CCACCCCGGATGTCGCCGGAATCCAGTTAGCTCTGGTGTACTTGGACTCCTTTGTCCCGCGAATTTTAATACGTGCCTTCTTAGCGATGGCTTGGTCAAG
CACCTCAGCAGTTCTCTTTCGCTTCGAGCGCGACGCTCGTACAGTATCTCGCTGTTGGTCAGAGATTGCCCGACCGGTGAGCGCAGTAATCGAGCAGCTG
CATGCCTCTCTGTTGCAAGCATCGGTTTTTTGGCTCCACATTGAATCTTGGCCAACCCTGCTTCAAAATCTGGACACTCAACCACTTCTCCACCAGCGGC
CAAATAGTAATTCATGTCATCATAGTCATCCAAAAAAATATCAAATATGTCGCGAATGGTAGTAGCTGTCATATCCTGACGTTGAAGCCGGCATGTTTTC
ACTTCAAAAGCAGTCATTTTGTTGGGAAGCGCGAAGAGTTTTCGCTGCTCACTTGGTAAGGGTATGAGGCCAACAAGTGGACTACGCCGGAGGTTTTCGG
TATTTATATTGGTAGTGGAGTCGTCACCGTCACTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTGATACTAA
GTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATT
GCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGA
GACCTTGTTAACTCTCCAACTTATGTACTGAGAATTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACACTCTC
CCTCACTAAGATGAGAACATACTGTTCTCGAACTTTCCTCAGCGAGGTCACGTCCTGTCAAGACGACGGAGGTCACTAGACCTCACCTCTGCGTTCTGCA
GCTCCACGAGCTCACAAACGCGCTCGCATCCTTGATGCCTGGCACTTCCACTCCGGCCCACGGCCCAACGTCTCCAGCGCGTCGCGCCGCCCCTGCCTCG
TCGGTCCCAGACCCCCAACTGCGCTCCGCAACTGCTCCAAGAGCATCTTCGTCTCTTTCGGTGGCACAGTACCACCAAGAGTATCGCCGTCGCCACGGTC
AACGCTCCATGAGCCGTCAACAAGAAGAGAGCAAAGCTCAAAGCTCGTCAGAGCCGCGGGCGCCGCCCAGAGGGAACGATGTTCTGTTCTCGGAACTCGA
AGAGGGCGAAGTCGATTACGACGAGCCCATGGTTAGTGAGGATCACTCCGGACCAACCTCTCCGAGGTCGCACACTGGTGCCGCGTCTTCCCCAGCTTCC
TCTGTGAGGTCTAGCCGCTCAACGGCGCAATCTCAAACAAGAAGAGACCTGCGGACACCGCATCCGTTCTCTGAACGTTCGAATCCGATTCGCTCGTTGC
GCGATGCGCCACCGCTATCGTCGCGGTATGACGAGGAAGATCGATACGATCACAACGTCATTACGAATGACCTGGACGAGGCCCAAGGCCGTCAGTTGTC
CAATGAGCAGCGCTCGCAGTCGTTCCGACCTGTGGTCCGACCACTTGTTCTAACGTCACGCCGTGACTACGGCTTCCAGACGCGGAACTTTGCCGGAGCG
GCCCGCCTTTCGGCGCAGCAGCCGCTGAACACGTACACGTGTGGGCCTGCGGCCTCGCCTGCTCATGAGCAAGTGCAGCGGCACCGGCTCCGAGAGCGAT
CTCTGACTCCACAAGTCACAACTCCTCAGGAGTATCAGGCGCGCCTGCATATGCAGCTCAACCGCCAACCGGTTCCCTCCATGCGAACCATTCCGGTTGT
TCTCAGCCCGGGGAATCCTAGCGTGCTTATATAGCACAATTCCGAAGCTGGGTGGAGGGAGCTCGACGGCTCCCCTCCTACAATGCTCTTCGAGCAAGTT
TCTCTGAAACTGATATTCGTCTTGAGAGACGTTTGCGCTTAGACTTCGCTAAGTCGAAAGCACGTCGACGGACACTGGGACCCCGTCCCCATCACCTCGA
GGCGTCACCACCTCTTGCTCATGCTGCGAGCACCGCTCTTTCCTATGAGCCGGCTGCTCCAGCCACTGGTCGGAGCTTGAGCTCAGCCACCGACCTGTCA
TCCCCGCGTTCTAGCGGCGGGAAGCGCTCGGCGCCTGACGACGCGGTCGTACGCCGTAGCGGCGGGGCAGTGAGTCTGCCCGATCAAAAGCGTCGACGAC
GTCAGGGCAGTCCTGCCGGAGGACAACCTCAAACTCCCAAGCGTTTTGTGAGTGAGGATAACCCCTCCATTTCACAAGGTACTGAGTACGACCCTGGCGC
ATGCGCCTCGCCATCAGGCGTTCCACATGGAAGTGGAGCTCGCCGTGCTCATCGAGCAGAGCAGGAGGAGGCCGAGCCTCAGCTGGACTCTCGCGTCGCG
AGTCGCAGCGACGTGCTCGCGCTGGAGCAGCGTGTGGGTTCTCTGAACCGGTATCTCCATGATACGACTGACTCTCTGAGTCGCCTTGCAGATGGTCTCG
ATGAGACGAACCACCGCGTGGACTGGTTTGAGCAACCACAGTCGGTTCAGAACCGAGTCGCGGACCTTGAGCGTCAAGTCGCTCAGCTGCAAGGTCAGAT
CGACTTGCTGTTGCG