Description :
From Genome Similarity Track
Location :
Scaffold_62:72600- 75209
Transcript NameFunction/comments
Aphas_H257_15014AlNc14C41G3494

Sequence
2609 bases(100 bases per row)
TTCACCTGCCTAAGTGCTTTTGGCAGTTCCCACTGCACCCAGACAGCTGGGACATGTTGTCGTTCATGCTGAACGGATGTGTGTACACCCGGATCGTGTG
ATGCAAGGCCATGTGGACAGTGCCCTCTACGTGCAATCAACGAACGAGGAGTGCTACAAAGACCTGCTCTACAAGAACATGCTGATCTGGATCGACGACA
TCTTTGTGTACGCCGACACAGTGGAAGAGTATGTGGATGCCCTCGAGTCGTTCTTCGATCGAGTAGCCCAGTACGGGTTCAAGCTGAGTCCGGCCAAGAC
CAAGCTGTTCACGGATCAAGCAAAGTGGTGTGGACGTATCATCAGTGGTGATGGCGTCAAGCAAGACCCTGAACGCATAGAACATCTGTGTGCGATTCCC
TACCCTACGAATGCGGCAGAATGCAGCAGTTTGTGTGCGCCATGAACTGGCTGCGGGACTCGATGACAGAGTACGCACAGACCGTCGACCTCCTGCAGCA
GTGTCTGACGAAGGCCCTCGAAGGCAAGGGCAAGAAGAAGCGGATCGCGTCTGGTGTTCAGTTCGAACTGACCGACGGCGAGAAGCAGCGTTTGACGCCG
TGAAGTCCAAGCTACGATCATCGGTGGAACTGTCTCATCCGCGTGATGACGCCACGATGTGTCTGTTTACGGATGCGAGCGATCATGGATGGTCGATTGT
GGTAACACAAGTGGTGGCATTCGATGATGACAGCCCAGTCCAAGAACAACGTCACGAACTGCTCTTATGTCAGTCGGGGATGTTTGCGGGCGTCCAGAAG
GCGTGGTCAGTCATCGAAAAGGTGGCCTACCATATTGCGCGTGCGTGCGAGAAGCTCAATTACATGCTTATGCGACCTACGGGGTTCAAGATGTACTGTG
ACCACAAGAATCTCATCCATGTCTTTGCCCCGGGCGAAGAATGGAAGGCGCACACACGCGGCAAACTCATGCGATGGGCTGCCATTATTGGCGGCTATCG
TTATGAAATCATACACATCGACGGCATCCACAACCTTTGGGCGGACATAATGAGCCGTTGGGGTCAGCCGACACCAAGTCTGGCGACCAAGCGGGTCAAA
ATACGTCGGGGCCATGGCTGGTCAAAGATAGTCAAAGCGCGCAAAGTCCCTCCACCAGCACAATCAAAACTGCGACCGCTGGACAAGGACTTTGTGTGGC
CATGTGTGGTGGACATCCGTCACGCCCAAGACCAGCATGGCAACGACAAACCGAAGCGAGCTACTGTGGTGGACGGACTGTGGCAAGTGGACGAGCGGTA
TGGATACCGAGTGCGGCGAATGACCTGATTCAACGGATCATGGTCGTTGCCCACTGCGGCAGCGCCGGGCACCGAGGACATGCAGCGCTGGTGGCTACTA
TCCGCCGCCTGTTCTATGTCGACCACTTGGCCGACAGAGCCAGTGAATTCCTCCGTGGCTGTTTGTTGTGCCCTCATGTAAAAGGGGGAAGGGTGGTCCA
TCGACCGTATGCTCCGAGATGGCACACAAAAGAACGCAACGAAGGAATCCACTTCGACTACCTCTACATGGGCGAAGCGTTCAGCGGCGCTAAGTATGTG
CTGGTACTCAAAGACGACCTTACTCATTACTGCGAACTCATTGCATGCGACGGACCCACGAGCCAAGTATGTGTGGATGCCCTGGTGGACTGGACAAAGC
GGTTAGGAATGCCACCAGTCTGGGTTAGCGACCAAGGAACCCATTTCACGAACGTGGCCATGAAGGCGCTAGCCCACAAGTTCAAGGTCCATCATGACCT
AACCTTGGCCTACTGCCCCTGGCGCAATGGAACGGTTGAGCGAATGATCCGCGACATCCTTCAAGTGATGCGGGTCATGTTGCGAGAATACCAGCTAGCC
GAACAAGAATGGGACTACCTATTGCCGGTGGTCCAAGCCAACCTCAACCAAACACCGGCAGCATCACTGGCGAGCAAGTCGCCGATGGAGCTGTTCACGG
CTTTGAACCCGGCGACTCCCCTGGAAGTCGTCGTGGTGGGCATGAACAAGGAACTCCGAGAGAGCGACTGGACGGTCAAGGACATCCCCAAAAACCTGGA
CAAGCTGCGTGCTAGCCTGCAAGTCATGCACAAAGAAGTCCTAGACAAGAATGTCATGCGTGTGGCGAAAGCAACGAAAGCGATCGAGAAATACGAACTG
TGCAACATCAGCGAAGGCGACTACGTGCTCTGGTCCCGTGTCGACGAACGCTATCACCCCAAGCTGCTCGTAACCTGGACGGGCCCCTACCGAGTCAAGG
AAGTGGGCGAATTCTCCGTCGTTTTGGAGCACTTGGTGACCCATTAACTGCGGGAAGCGCACGCATCAAGAGTCAAGCTCTACGCCGAAGACAGCTTTGA
AGTGACCGAAGAGATCCTCGAACAAGTTTCCGAGCAAGGAATCATGCTGAAGGTCAAGTCCATCGCGGGACACAAATTTGTCCCGGATGTGAAAGACTTC
ATGCTGGAAGTGCTTTGGGAAGGTTTTGAAGATATCGAGTCCTCATGGGAACGGCTGCAGAAGCTCATGCATGAATACCCGGCTGTGGTGAAGATCTACG
TTGAAGGCG