Description :
From Genome Similarity Track
Location :
Scaffold_400:726- 2309
Transcript NameFunction/comments
Phyke_g9214hypothetical protein
Phyke_g9215hypothetical protein PHYSODRAFT_518857

Sequence
1583 bases(100 bases per row)
AGGTGGTTGGGCCTGACTCCCCAGCCACGGATCGTTTGCTCCCTGCTAGGCAACACAAAAGGTTCCTGCGCGTCGAGAATACCGCGGgcgaggatgatga
agagcggGCTATATCAGCTGGCGTGCTGGGCAAAGTTTTCAACAAGGTACCGTCTACGATCAAGAACTCGAAAGTTGGTTCGAAAGTGAGATACCAATAC
TGGCTCAAGCGCGGAGAAGACCCGAAAAGTATACACAAGAAGCTGGGACTGAGCGGTTTGACGCCGATAGAGGCAGAggcgaaggtggtggcgtTTCGTG
ACTACATGGGGTTTTCCAAGTTGTGGAGAGAGCAGTAGAGTTATCTACTCGACAAAGTGAGGATGAGAATAGAGTATACCCTCTACCCTtgccagcatct
gcagcttggatATCGTTCTTCATATTGATGGATTAGCGTGGCCAATCAAGTTTATTGCGTATTCGGCCGAGAGCGAGTTTGGGTAAACTGGCACTGCAGC
CATTTTAGTGCAGGCTTCGATCAATGATGCGATTCGGCTACCCCAGTATAGGCGACTGAGCGCTGCGCAACAACAAACTGATCGCAACCAAGTTTTTTGT
AAATACAGAGGTGTCTTGCTCACTGTGGGGCAGTGCTCTAGTAGGCAAAGCATACAGACAACTTCACAAGATGATAACAGTCACATCCATTGCCTAAGTC
ACTTCTGTTGTGCAGATTGCTGCTACCGGGATCAGCTTAGATCGAGTCATCCGCAAATGAGCTGCGGAGGCTGTGGTTGCCAGATGTGTAAAAACTACCG
AGACCGCAGGGAGAAGCAATGCATTCCATTAGACTTTAGATTTTCCGGTTGCTGTAACGCGTGCGATTCACGTCTCACTGAAAAGCGAACCAGCCATCAG
ATATGTTATAATATTGGAGATCAATATCATCCCTTTCGTGGGGAGCTGACATCGTCACTACCTGACCAATTCGTGTCTTCCCATATTTAGAGGGGGTGCA
GTGCTCTCGGAATAGCTCTGTCGATAGAGATCGACACGCCGCGAACGACTTTAGTCTTAACCACCACGAGCAACTGCGTAATGAAGCGAAAGGAGCTATT
GACAGTATGCGAGCAGCTCATCAAGTCGTTCGATCCCGCTAAAACTACAGTGGACGCTCATGCGACGGAGGAGCTTCGAGGGTGCTCGTCTGTAAGTGAC
CAGCGatttctgcagcaagttCTCTACGGGTCCTACCGCTATCGTGAACTACTGCGTCCAATGCTGACGCATTTTTTAGATTCCCACTCAAGCCAAGTGA
GTCGCTCAGACTACACCATGTTCCTCATCATAGGGTACTTAGCCATCTTTCGTATTGAGGAGCTCGGTATCCCTGCGTTTTCCGGCTTGACGTTGGCACT
CCAACCTACCAGTATGCACACCTTCCTTTCTTACCTTTTTGACCCGAGCCAACTTCGAGGAACTCTGTTCACGCAATGGGCCCAGGTTCTCGATGCCGAT
TTCGTTGAGAAGAATATTATCGACAAAATGATGAATTTTAAGCCGGAGATTGACAAACTCCTTTCGCAACTTCACACCAAAGC