Description :
From Genome Similarity Track
Location :
Scaffold_334:726- 1923
Sequence
1197 bases(100 bases per row)
CTGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTTTAATATGATGAAGTCATCATCGTAT
TGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATCCTCGTTGGAGGGATCT
CTCGCTCAACATATTTGAGCTCTCTTTTTTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGTCCCACAATCGACTAGAGCTCGAAGCGACATGCCTTG
TGTCACTTCGAGTTTCAAGGTAATGAGGAAACCTCATTACCAGAAGTAGCAACACATAATGACTGAGTGTTGGGAGCAACTTTCGTTAAGAGGCCTGCAA
ACTCACTTGACGTTGCTGTATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCTTCGCAACAACGTCGGACCCACGCCTTGGATC
CCGCTTGGCCGCTTGGCGGTTATTGTTTCCTGTGGTACGTGGTACCGCTCTCGGGGCAATGCATTCTTATGCATAATGCCCTGTACTCTGACATCTATTG
TATTTTTGCAATTTCTTGTAGTTGTTAACACGAGAGTTCTCGCTCCCAGCGTGACAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTTGACG
GACCATAGGAATTCGAATTCGCGTGAGCCTGTTTCACACTGAAGTTCTCCTGTTTCGCAACCCTTATTTGCCTCTTCTAGGGTGTTGAACTCCAACCGGA
ACAGTTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTG
ACGTATGTACTGAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGCTCAGATAGAGCCCTGAACTCCGCTCGTGGCAGCTCAAAAGTT
TGCCTTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCA
ATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACGAACCGTCTCAACAGAGAGTCTTCATC