Description :
From Genome Similarity Track
Location :
Scaffold_76:72555- 81640
Transcript NameFunction/comments
Aphas_H257_15335HEAT repeat protein (DRIM)

Sequence
9085 bases(100 bases per row)
CTTTCTCTTCTTGAGCTGCTTGGACTCCTGCTTCCTCGAGTTCTTCAAGATCTTGCGCGCCGCCGCCACGTCCGGCTCAGCCACCGCCTCAATCTTCCGC
TTCTGCTTGCGGCGCTCCCGGAACTCGGTCACCTTCTTCTGCACGTGGGCAAACGTCGACACGAACACGGCCGACTCGACCGTGGCTTCCAGCACCTGTA
GCACTTCCTGCGCGAGATTCCGGATACTTGCAGAGTCATCCGGATCCTCCGAGTCGTCCACAGCTTCGTCGTGGATGTCGCGGTAGAGCGGGTTGATCAT
CGCTAGCAAGACAGTTGCTAAGAAACTCGAGTCTTCCTGGACAGCTGCGCCGGCAAAGAACTTGTACACGGCCGTCTTGCGCAGGGGGAGTTGGTACCCT
CGCGCCAGAAACGACAGCCGCGTAAACAGCCACGTGACCGGGGACGACTGTTTCGTAGCTTCACTCGATGCCTCGAGTGGCTCTGCAACGACGACGTCAG
CAACGTCCTCGTCTTCTTCATCGACTGTAGCCGTTTCGGCCAACGACACGGCCGCCTTGTGATGATGCTGGTCAATGTGCGGGTGGGTCTGCAACGCCCG
CAGCACAAACAGCAACGTGGGCACGATCTCGGCGACCAACGCGTCCGTCAAATATGAGCTCTCGAGTTGCTTGCATAGTTGCTGGGCCATTGCAAACAGT
CGCCCCGGTTGCTCCAGGTACACCACGACATGACCGTCTTGGTTGGTTCGCAGCAGGGTCTTCGGGCTCCGTCCGTGCACGTACCCCCGGACCACCCGCA
CCGCCGCCAACCGGACCCACGCATGCGGAAACGTAAGCAGTGCCACGACCGACTCGAGCACGGACGGCGCCCATGCCTCGAACACGTCGTGGACGGACGT
GCGCCAGGCGTCGGCGCACAGCAGCGCGTAATACGTCGCCTCCCACTCGACGTCGGCGACTTGTTTGCCATCTTCTGCTTCTTCCTGCTCACCCATCGCA
TCCACTGCGCGGGCCAGCGCCTCGCTCAACTTGGTCGTGACGAACGTGGCTTGCTTCTTGGCCAGATCCGGCCGCGCGGCGACCACGAGGCCGGTCACGT
GCGCGGCGGCACACTGGAGCTTGGGGTCGGCGCTTCCCCACCACGGCTGCATGAGCGCGACGGCGTCGCCAAACACGTTGGCCGAAATGCGCTTGAAGAG
GTCCGACACAACCGCCGCCGCGAGCTCACGGACCGGCGCCGCGTCGTCGTTGACGAGTTGGAGCACGAGCGGCAGCAAGAAGAACTGCGCGCGGGCATCC
AAGAGATCCGACGGCAACTTTTTCACCTATGATATATATATATATATGAGCATTGTCCAATCAAAACACCCACAGCACACGATCAAGTAGCCAATCAAAT
CCACGCGTCGACTAAATTGGTGTGTAAATCGATTGATTTGGCAAAAAAGTCAGCCACATTTTGGAGTACCAGGGCATGCAAACACTCGAGCGACGACAGC
CGACCCGACTCGTACACGAACGTGAGGTTATTCACGAGGAACCGAATGTGAAAGTTGAGTCGCTTGTCCCCGAGGGGGTAGTCGAGCAGGAAGAGCAGGT
ACATGCTGCCGCAGTTGGCGCGCACAGTCGCCACTTGGCTTTGCACCATCATCTCCCCCACGCGCACCATGAGATCGTACACTTCGGCCACGACCAGCCG
CCGCCCGAGCACCGCCTTGAGCAGCGTAAACGTGGCGTTCTGATGATCCATCTCTTCGACGTCGTGGCGGAGAAAGCTGAGGAGCCCCCGGAGCTGGCCG
TCGTCGAGTCGGTACTCGCTGCGTTCTCGAATCAGGACGGACAGAAGGCGGTAACACGTTTGCGTCAACTCGTTCTTGGTCGCAGCGCCAGCTTTTTGAA
TGATCTACACACAACAGCCATCAATATACATGCTGCGACGTGGTGACGACATGTGACGACGTTTTACCTTGAACACTCGATCCACGACAGTGCTCAACCC
TTGGAGGAGCGACGGGAACGGATGGTTGAGCATCACGGCGACGCACTTGAGCGCCATAATGACAGTATCCGTGTGCTTGATCTCGTTCAGACAGCGCAGC
AGCAACGGCACGAACGGATCGAGCAACGTGAGCGCGGACGCATCCTTCTTGAGCAACGTGTAGAGCAACGTGACGGAATACAGCAAGATCTCGTCGGCGC
CAGAGTTGGCCGCATCCTCCTTGGTGGCCACGTACCGGTCAAAGCCAGTCATCTTGGCTTGGGCTTCGATTCGGAACGTTTCCCACGACGACACGCGGGC
CTGCGTCCGGCGTTTGGTGCCGATCCAGTCGAGCACGAGCCATGACGACACGCCCCCCGCGTCGGCATGCAGCGCCGCCGCCTTGGACGCGTCCGTCGGC
TGGAGGTACGTGAGCCGGTTGAAGCACATGTGCAGCATATTGAACAAGTACAAATACATGTGCGTGGCCTCGACGCTCTTATTTTTCGATAGCCCGAGCG
CGACCCGCGACAGCACGGTGCGGACGTTGAGCAGGACTTTGCCCTTGCGGGAGGCCGAAGTGCTCGCGAGCGACTGCACAACCGGCAGCAGCAGCGTGTG
GATGGTCGGGTTGGGGAGGAAGTTGATGCACCGCGCGAGGAGTTCGAACGAGTCGAACGACCGGCAGGCGCGGGCTTCCTTGGTCTTGGACTTGCTGGCC
TTGTCTTCCCGCTCGTCGCCGACGTCTCCAAAGATATCGCGCACGAGAATCGCCACGATCTTGGGCACACATTCATCCAACGGCGACGCAAACAGGATGG
TCGTGGTGGTTTCAGTTTCGGTTTCAGTGAGGGGGGGCGGCGCGCGTTGCTCGCAAGCGTCGGCAACTTTCTCTAGAATCGCAAACAACGTGTACGACAA
CACGTGCACCATGAACCCCATCTTGAGCGAATGTTCGAGCTCCGACACGACTGCGACAAGGTACTGCGGCCCGAGCTCGACCGCGATCCGAACCAGCGTC
GTGCGACTGGATGACCGGACCACTTCATCTTTGGACTTGAGCAACTTGGTCACTTGCATGAGCAACTTGGGCAACTCTTGGAAGAAGACGTGCGCGGGTA
GCCGACGCAGTAGCTTGACGATCGCCAGCGCCACCGGCACCCGCAACACGTAGTCGCCGGTGGCCGTGCCCTGGTCGTCCTTGGCGCTTTTCCCCTTGCC
CTGCTTGCGCTTCCCTTTGGTGAGGAACGTCTTGAGCATCGGGAGGAGCGACGTGGTCATGGCCGACTGGATGGGCGTCGCGGGGACGACGGCGACGGCG
GCGCGGTCCTCCTTGGACGCCTTCCAGCCGTCCGATACCACAATGCCCTCAAAGTGGAAGTGGTCGATGATTGCGCACACGGACGCAATGATGAGCGTCT
CCGAGTCGGGGCGGGTCGGGATCTGCTTGAGCAAGTTGCGCAGCAACGCCGAGTAATTGGTCCATGACAAGAGCGTGGCCACACTCCCAAGTGCCTGCGC
GGCCTCCCCGCCGACGCCTTCCTGGGCCTTGGCTTCGTACACGACGTGCTGAAGCAGCGGCACGAGGATGTTGTGCGCCGTCGTGTTGGATAGGGTCGCG
TAGTCGCCGCTGTCGACGCCATGCTTGAGCTTCTGGACGGCGCGGAGCCGGCGGTGCGCTTGAATGTGCGTGAGGTTGAGGAAAAAGTCGACTTCCGGGT
CCTCCTTGTTGCGAAGCACCGAGAGGTCGCCGTGGAAGGATGGACTCGCGTGGGTTGCAAAGTGGTCGGCGACCACCGAGAGCAGCAAGACGAACCCGCG
GCGGATGTCCTCCACCGGCGACTTCAAACTCACCCGGACGCACGGCATGAGCACCGTCTCAAACACCCGAAAGAGGACGCCGTTGCTGTCGTCGGTCGCG
GCGAGCGCGATCAGCACCTCCAACCCCGCCTTGGCCGCATTCCGGAGCGAGTACTCTGTGTCGTGCATGCTCTACAACATCATCTTGTCAAGTCCATATT
CGAAATGGAAGTCGGGTGCGCTAAAGAGCAGCACCGTATCGCACACAAATGATCGACCAATCAAAACCCAGATCACGAACCAAGTAGCCAATCAAATCCA
TTCTTCGACAAATGCAACCTCGTGTGACTTCAACAAGTGTGACACAGGACGAGTTTTACATACAAAAAGTCAAACAATCGATAGATTTGGCGAATCAAAA
GGCCACATTTTGGGTAAAAAGGACTCACAATACCTGAAGGTACTGGCTCACGAGCGGCACCAGCGTGACCGAGTGTTCGCGGAACCCGTGAAATTGAATC
GAATTGAGCGCTTGGAAGGCGCTGATCCGGCGCTCAAAGTCGGCTTCTTCGAGGCGTCGGGCGTCGAGGGCGTTGAGGTCGAGCAGGTGTTGACACATGG
CGGCGAGGTCCGTCGCTCGGGGATGCACTTGGATCGCACGGAACACGTCCATGAGTTTCTGGCGGGGTTGCGGGTCCGAGATGCAGTTGACGCCGGGGGC
TAGCAACTTTGCGAGAAAGTTGACGTGGGCGTGGGGGGCATCGAGGCACGGGATGAGCCCCGACACGACCTGGAACACGTGCTCCTTTTCCACTGGCGAC
GTCTTGTGGTTGCGCGTGACGAACGGCAACAGCAGCGTCACCAGTTGGTGCGCCGTCTCGACGGTCGTGCCGCCGCGGCCAACATGGGGCGCCAGTCGGC
ACAGAAAGTGCAGCTCCTTCTTGGACGACGCACCTTGCTTCTTCTTGTCTTGGATGAACTTGGCGGTTTTAGCCTGAAACCGAGCAACGAACTGGTGGAG
CACAAACTCGAGCTGCGGCAAGAGTAACGACGTGAGCAGCGCCTCGTCCGCCGTGAGCAACCCGTCCATGAACCCTAGCACACACTCGAGCACGTCGTGC
GTGATGGTCACGTTGAGGTGGGCGCCGCTGCCCAGACAAGAGAGCACGCTCCGGACGATCTCGGGCGTGAGTTCCGTGACGACGGACCCCGACACTGCCA
CCGCGCGCAGCCACTCGAGCAGCGCCGACGGTTTCTTGGCGCCGCGCATCGCGTTCGGCAAGTGCAATATCGACGTATGGCACAGCGCAAACACCATTTG
AAAGCACTCGTGAAATGCATACTGCCCGTCAAACTAGGGAACAAACCACAAATAGTGTTACAGGTACTAGTAGTTAGTAGTACTAGTAGTACTAGTACCT
GGTCCACGATCTGCGTGAGTCGGCGAAACGTGAGCATTCTCGTTTGCTTGCGGAGACTGTCGTGGTGGTGACCCTTTTGAAGAGGATCTTCTTCCCCTTC
TTCCCCTTCCTCTTCGTCCGGATCGATGTTGTCGGCGGCGTCCTCGCCCTCCACAACAGGCAGGGGCGCCTGCTCGTCATTGTCCTCGTCATTGTCACCA
TCGTCATTCTCATCATCGACATCGTCACCATCGACGAGTTCGTGTACAACTGGATGTTGAGTCGGAGCAACGACGTCAGCAACGGCCGACTCGTCATCAT
CGTCGACAAGAGCATCGTTATGGTGGATTTGGCCGACGCCGTCGTGGCCGAGGATGGCCGTGAGGATCGCGAGGAGGTCGGGGAGGTACTTGGTGACTTT
CATGCCGAGTTGCCCGACAACTTCCTCCAGAACGTTGAGGAATCCCACTTGTTTCGACGCCGACACGTTTGCAATCGCGGCTTGGGCGTGCGCGACCTGG
GTCGTAAAGCCGTGCGTGCCGCCGATCGATGGGAGGTGGAATGGACGGCAGATCAGGTCCACAAAGTACACCAGTTCGTCCGGATCCAGCGCCACGATGA
ACGCCAGCACCGTGGTCCGGCGGTGCGCGAGCGAGTGCTTGGCGCTGCGGGTACCCTTGCGAGTGATAAACTTGGCGTACAAGATCCGGACCAGCACCGG
CAGGACGCCGTCGCGGTGCTCATCTTGGAGCGTACCCGACGCGCGATCGACCTTGAACTTGGTCAGCGTGTCTCGAAAGGACTTGGGGTTGCACAGGTCC
TCTAGGGGCTGGCGGTACGGCAGTAGGTACGCCGGCTTGAACGCAAATAAACAGTCGAGGGCGCCGCGGGAGAGCCGGTCGTCGGCTTTGAGTAGCAACG
AGTAGAACAACGACCAGAGCAACTCGTGCCCGTACACTCCCTTGTAGTTGGTGAACCGCTTGAACAGGTGGAGGAACGACACGAGCTTGTCTTGCACCGA
CTTGGCAGTCGGGACGACGACAACTAACGTCGACGTGAGTTTGGGGTGGTGCGTGGCGTACTTGGGGTTGGCCTCGCGGGAGACGGCAGCGGACGCGATC
AGTGCCGTCAGGTCCGCCGCCGACACGCGGTCAACTTCGTCCGGATACACGGCGTAGTACTGATCGCGGAGGAACGCGCAAAACACGGGCACGACCACCT
TGGACTTGTGCTCAACCAAATGGGCAAACGTTTCCAGCATCTTGTACACGAGGCCGTGGTGGGTCACGGCGTCCGTCGCGGTGTGCGCGGTAGAGCCGAG
TTCGAGCACACAATCTCTGGCCAACGCAGCCACGAGGCGCAACGACGTTGGCGAGTTGTGTTGAGTTGTTGCGTTGGACGAAGTGGTGGAGTTTGCCGGC
AAGTGGGCGAGCAACGCCGCCGGTACCTCAGCCGCCGCCACCGACCGCGTCGATACAAACTCCAACTCGTCCACCACCACGTCCCAGATCGAGTCAAAGT
GCACCGACACGGCGGCCTGCACGACGGCCGACACGTGGGGCCACATGGTCGAGAGCTTGACATGGAACAGCCCGAGCATGTGCGACACGATCAGCTGGAT
GTACAGCGTCGGCACCTGCGTCGACCGCGCGAGCACCTTGAGCCGGTCTAGCAGCCGGATGAGTTGGCGCTCCGTGTCCACGGACGGAGTCGCCGCGGCG
TCTTCGAGCTGCAGACAGATGGCCACGACATCGCAAGATCCGTCCAGGGTACCCGCGGCGTCTTGGGAGGCGAGAAACGGCAGGGCCGGGGCCAGCGACA
GCAACCGGAGCGTGTATTGACGAAGCGAGTGGTTGGAGCTCCGCAAGTTTCGGTGTAACAGCGGGTACCACGACTCTACCGACAGAAGCGGCGACGTCAC
GGCGTACGACTGGATGGCCAGCACCATGTGGGGCGACGTCGGGTGGGGCGCGAGTAACTCGAGCAAGTCGGCTTCGGACGTGGCTGTGTTTTGGATGGAT
GCCAGTCGGCCCAGCACCGCGAGGCAGTGTCCGTGCAGCGCCGTCAACGCCGCGGCGGTGGCTTCGTCTGAACTGGGGAGTAATTGCAGCAACTTGCTGC
GAAACGAAGCCACGGACGCGGTCACGGTCGCGGGCGACGACGTCTTGAAGAACGCGAGGCAGCGCAACGCCTGGCGGACGTTGGCAATCTTGACCAAGTC
GTCAGTGGACGCCAAGAACGAGGCGAACGCTCCTTCCACGACGGCTTCGAAGTGCCCCATCGCTTGACTGGTTACCTTGGCCAGGTCGAGCACGACGCGG
CTGGCTTGGCGGGTGAGCACGCCGCCGCCGTAGGTCGCGTCGACGTGCTGGTGGAGTTCGATCCAGTCGACGAGTACGGAAAACGACTGGAGCAACGCCA
CTGGGCCCTTTTGGTGTTGCGCAGCGGCGTACAGCGACGCTTTCGGCAGCACATATTTGGCCACAGCAATGACCGGCAGCAACGACAGCAGCTTCTCCGT
GAACGCGTCCACGTCGGCGGCGTCCGGGAGCGTCGGCGTCGTGTAGATGGTCCCGATCGCGTCGTAAAAGTCTCCCTGGAGGGCAAATGCGCACTGACTC
AGCAGGTTCAGCACCGACTCGCGCAACTCGTCCGTGTGGGCGACACACTTGGACAGCAGCGTCTGCACCACGACCAGCAACGGCCGACGAATGGCGTCGC
CCTTGCCGACCAAATCGCCTTGCTTGTACGAGACAAACAGTGCGACGAGGTTGCACAGCCGCGCGATGTACGCAGGAGCTGGACGGACGGCGGCGACGGC
GCGGGAGGTGGCGTCCAGGAGACTCGTCCACACCACTGGCGCGTGCTCGGCGGTCGTGTACCGTCGGAGCATGCCGACGACGCGCTTTGAAATGTCGTAG
ATCACGTGGTCGTGGTTGGTCGGGAAGGTGGCTTGCTCTGCAGAAACTTGCTGGGAAGGGTCAAATGCCTGTAGGAGCAACGGCAGCAACTCCTTCGTAC
GCGAGTGAAACTGGGCTTGGACGTTCTTCATCACGGCAAAGAACAGCTTGGCCGTTCCGTCTAGCACGTGGTCGTGGTCCAACAGGGACGACGCGTTGCT
CCCGTCGTGGCTCGTGATCCCGCGCACGAGCGCAGACAAGTACTTCAACACGTACGACTGGAATGCATGTCCAGATTTGACCTTTCGCAAAAGTACTGCG
AATACATTGGCGGCAAACTCGCGCACATATTCCTGTGGGTGGCCCACGAGCACGCTGTAGAACTTGTGCAGCACGCTCATATCTGCGAGAACTTGGGCCT
GGAGATGCTTGAAGAGCATGGAGAGGGTCTTGAACACGTCGGCGGTCAGTTCAGGCTACGCAAAAAAGTTTGCGAGTTAGTTGCAGCAACGGCGGAAGTA
AGCAACAACGTACGTTGGTCTTGTCAATGATCGACAAGATGTGCGGCAACGACGTGGCAAAGTGCGGGTAGAATTCCTTTTGCAAATCCCTGCACATATA
TATGAGTACGAGAACAGAAAGTAGTACATCGATCCAATGCTTACTTGGCGAGCGCGACGTAAAGCTTGAGCACAGGGATCATCACGTCTGGGTCCTTGGG
AAAGTCGCGGACATTCGTCTCGAGGATGGCCACAACTTGGGTCAAGTGATGCAGCAATTGCGGTGTCGAGTTGGTGATCCGACGCAGCTTTCGAAACAGT
TGCTGGAACCGCTCGTTCGTGTACAACTCACCGAGCAACGCGAGCTCGTCGTGGAAAGGCTCCGTGGCTGTGTTGGCCAGCAGAAAGTTTGAGTACGACT
GGGTCTTGGCATGCAGCTGGAGTTCCGACTGTAGACCCGCAATGCGCTCCTTCCCTTTCTGGAAGCGGAAGCGCTTCTTGCTCGG