Description :
From Genome Similarity Track
Location :
Scaffold_630:7254- 8316
Sequence
1062 bases(100 bases per row)
CTCCGCCAATAACAGGCGTCGAGGTAAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGGGGACGGTTGCAAACGTTCCGCACCGGAAAAA
CTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGTGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGCCGGTACTA
AAGAAGAACACCCGTCCACGGCTGGGCCTGGATGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGGAAAACAAGAAGACGGTGCATGCGAAGGTCGCTCCG
CAAGTCTCGGCCTGGGGTCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACC
TGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGCTGACTTCACTTCCAGTCATGAGCTGGAAGCGCTTCGCGC
GTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAC
CACCACTGTGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAATCCCTACTACGAGATC
TTACGGAAGTACGCGGACGTGCTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGT
ACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAACAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAA
ATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGGACGATGCGACGATACCGGCG
CAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAG