Description :
From Genome Similarity Track
Location :
Scaffold_42:7252- 9225
Transcript NameFunction/comments
Phypl_g1593methylcrotonoyl-CoA carboxylase subunit alpha, putative
Phypl_g1594L-aminoadipate-semialdehyde dehydrogenase large subunit, putative

Sequence
1973 bases(100 bases per row)
cttggcctgcagcaacCTTCAGCTGCAACTCAACCAAGTCTTGCTTAGTAATCATTTCAGTGACAGGATGTTCCACTTGTAGACGCGTGTTCATCTCCAT
GAAGTAGAATGACTCGTCCTCATCTAGGAGGAACTCCACCgttccagcgccaacgtAGCCCACCGCCTTcgcagcggcgactgctgcatCTCCCATTttc
ttgcgcagcgcctccgacATGTTGGGCTATCAAATGTTACAGTCCACAAGCGTCAGTTAAATCCCCGACAGAGCACAGGTTTAGGCTTGGCCTGACTTAC
CGCAGGAGCTTCTTCCAAGACCTTTTGATGCCGTCTTtggacgctgcagtcgcgctCGAACAGATGAATGACATTCCCGTGTTTGTCTCCGAAGATCTGG
AGCTCCACGTGCCTCGGCTTCCTCAGATACTTCTCAATCAGCACTTGTCCGTCTCCGAAGGACGCCTGGCCCTCCCTCACACAGGCGTCCAGCGCATCTT
GGAAGGCCTTGTCGTCATCGACGATCCTCATGCCTTTGCCTCCACCCCCCAGCACGGCCTTGATGAGCACGGGGTAGCCGATCTTCCTGGCCTCTTGCTG
CAACGTCTCGAGGCTCTGGTCTTCTCCGTGATAGCCGGGGGTCACCGGGACGCCGGCCTTGATCATGATGTCCTTGGACGCGCTCTTGGAGCCCATGTCC
TCAATGGCCTTGACCGGGGGGCCGATAAACTCGACGCCAGCCTCTTGGCACGCGCGCGCGAACGCCGCGTTCTCCGACAGGAAGCCGTAGCCAGGATGCA
CCGCTTCGGCCCCGGAGAGGCGGCAGATCTCCAGGATCTTGGGGTAGTTCAGGTAGCTCTCGCTGGCGGGCGCGGGGCCCAGGCGGTAGGCCTCCGTGGC
CAGCTTGACGTGCTGCgagtcggcgtcggcgtcacTGTAGACGGCCACGGTCTCCATGTTGAGCTTCTGGGCggagcgcagcacgcgcagcgcgaTCTCG
CCGCGGTTGGCCACCAAGATCTTGCGGAAGCTGCGCGGGGTCGTGGACAGCGCGCGCCGCGACGCGGGGCCGCGCTCCAGAgagcgctggaggagacgga
gacgcagcaTGGCGGAGCGGAGAGCTGCGGAATGAccgcagacgctcgaggGGGACCGGGTTGAAGTAGCTTTGACTTCAACAAACGAGTTTTAAACTTG
AGTAATACATGTTGCGAATTAACATGATTCAGTAAAAAACGATTGTCTATTTGTTTTTTTAATGGTAAGGAGTTGGATGACAGCGCGCAGACAACTTTTT
TCTACTGGATTACGGTGACGCATCACAGTCTAAGATGGTCTTGATGAGATTTGTATGGGATCGGGAGACGACGTATGCATCGGATGTTCGCTGGAGGGCT
CACCACTTGGCCGTGtacgtggccagcagcgcctggttGACCGTCGGGCACGAGACGCCggcggcctgcagcagctcggccgagaGCGTCGAGTCGAACA
CCTTGTCGCTCTGGAAGTAGACCTCGAACGAGTCCATgcccgccgccagcttctgcagctccagcggagCGTCCGTCTTGGCAGCGGCCTCATGCAGACT
CCGCTTCCACTCCGCGTACTCGACTGCCGCCAGTTTCTTGCCTGCCATCGCAGCCGTgaagaactggaagaacgCATCGCTCTTGACGGGCAGCGACGGG
TTCTGGATGTGCAGCGTCTggcccagcgcctccgccggACGCACCGCAGCGAAGTGCACAATGGCACGGGCTGCGTAGTCCACGGGGGTCATGTCGAAGT
ACCAGTCCGAGCGAGCGGGCACGACGCCGAGCCCCGCGCAgcccttgagcagcaggtagaTGAAGTCGCTGGCGTTCCACTGGCCCGTAAGCGAGGATGG
AGCCATGTTGCCGGGACGCAGAATCGACACGGGGAGACCACGGTGAGCAGCCTCGTGACACATTTGCTCGGCC